REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Live/dead fixable Aqua Dead cell stain kit	Thermo Fisher Scientific	Lifetechnologies
anti-mouse CD8a - PE-TexasRed	eBioscience / BioLegend	RRID: AB_10374589
anti-mouse CD62L - FITC, PerCP-Cy5.5, BV711	Thermo Fisher Scientific	RRID: AB_465109
anti-mouse CD44 - APC-Cy7	in house	N/A
anti-mouse CD127 - APC, PE	eBioscience /in house	Clone A7R34; RRID: AB_469435; RRID: AB_465845
anti-mouse KLRG1 - PE-Cy7	Biolegend	RRID: AB_2561736
anti-mouse TCF1/ TCF7 (C63D9) Rabbit mAb	Cell Signaling	RRID: AB_2199302
anti-mouse CD45.1 - PerCP-Cy5.5, PE	eBioscience	RRID: AB_2534309
anti-mouse CD45.2 - APC-Cy7, Pacific Blue	in house	N/A
anti-mouse Thy1.1 (CD90.1) - PE, APC	Thermo Fisher Scientific	RRID: AB_2534975; RRID: AB_2535002
anti-mouse IL2 - PE-Cy7	Biolegend	RRID: AB_2561749
anti-mouse IFNg - PerCP-Cy5.5	Thermo Fisher Scientific	RRID: AB_906239
anti-mouse TNFa - Pacific Blue	Biolegend	RRID: AB_893639
anti-mouse CD107a (LAMP-1) - PE	BD	RRID: AB_1645247
anti-human granzyme B - PE-TexasRed	Invitrogen	RRID: AB_2536540
anti-mouse PD1 (CD279) - APC, PerCP-Cy5.5	Biolegend	RRID: AB_10550092; RRID: AB_10613470
anti-human TIM3 (CD366) - Pacific Blue	Biolegend	RRID: AB_2632853
anti-mouse LAG3 (CD223) - PE	Biolegend	RRID: AB_2133343
anti-human CD3 - BV711	Biolegend	RRID: AB_11219592
anti-human CD8 - BV421	Biolegend	RRID: AB_2629583
anti-human CD4 - AF532	Thermo Fisher Scientific	RRID: AB_11218891
anti-human CD45RA - BUV395	BD	HI100
anti-human CD45RO - BUV805	BD	RRID: AB_2872786
anti-human CD62L - PerCP-Cy5.5	Biolegend	RRID: AB_893396
anti-human CCR7 (CD197) - Pacific Blue	Biolegend	RRID: AB_10915695
anti-human CD95 - PE	Thermo Fisher Scientific	RRID: AB_465788
anti-human CD27 - BV605	Biolegend	RRID: AB_2561450
anti-human CD28 - PE-Cy7	Biolegend	RRID: AB_10644005
recombinant human Fc-tagged Her2/ErbB2 protein	Sino Biological	Cat# 10004-H02H
anti-human-Fc Alexa Fluor 488 conjugate	Thermo Fisher Scientific	RRID: AB_2534050
anti-human CD19	Biolegend	RRID: AB_314238
HRP-labeled secondary anti-rabbit	Santa Cruz Biotechnology	RRID: AB_1500696
HRP-labeled secondary anti-mouse	Santa Cruz Biotechnology	RRID: AB_2536527
Acetyl-Histone H3 (Lys27) Rabbit mAb	Cell Signaling	RRID: AB_10949503
Tri-Methyl-Histone H3 (Lys27) (C36B11) Rabbit mAb	Cell Signaling	RRID: AB_2616029
Histone H3 Antibody	Cell Signaling	RRID: AB_331563
anti-RUNX1 antibody	GeneTex	RRID: AB_2885895
Phospho-S6 Ribosomal Protein (Ser235/236) (D57.2.2E) XP Rabbit mAb	Bioconcept	RRID: AB_916156
4E-BP1 (phospho Thr37/Thr46) antibody 4E-BP1 (phospho Thr37/Thr46) antibody	GeneTex	RRID: AB_2886856
Monoclonal Anti-b-Actin antibody	Sigma-Aldrich	RRID: AB_476697
a-Tubulin (DM1A) Mouse	Cell Signaling	RRID: AB_1904178
Acetylated lysine antibody	Cell Signaling	RRID: AB_331805
Annexin V PE	Biolegend	Cat# 640907
Bacterial and virus strains
Recombinant bacteria Listeria monocytogenes deficient for actA and expressing the ovalbumin (Ova) peptide SIINFEKL	In house	N/A
Chemicals, peptides, and recombinant proteins
UK-5099	Sigma-Aldrich	Cat# PZ0160
DMSO	Sigma-Aldrich	Cat# 34869
LDHA inhibitor GSK 2837808A	ThermoFisher Scientific	Cat# 51-891-0
Torin2	Sigma-Aldrich	Cat# SML1224
RBC Lysis solution	Qiagen	Cat# 158904
Golgi Plug	BD	Cat# 51-2301KZ
Golgi Stop	BD	Cat# 554724
Trypan Blue Stain 0.4 %	Invitrogen	Cat# 15250061
Fibronectin	Takara Clontech	Cat# T100A
Bovine Serum Albumin	Sigma-Aldrich	Cat# A2153
Cyclophosphamide	Sigma-Aldrich	Cat# C7397
Propidium iodide	Biolegend	Cat# 421301
Peptide Ovalbumin amino acids 257-264 (OVA) (SIINFEKL)	In house	N/A
Percoll	GE Heathcare	Cat# 17-0891-01
Recombinant human IL-2	Peprotech	Cat# 200-02
Recombinant human IL-7	Peprotech	Cat# 200-07
Recombinant human IL-15	Peprotech	Cat# 210-15
Lymphoprep	Axonlab	Cat# 1114545
CpG-ODN 1826 oligonucleotide	Microsynth	Cat# 45355
U-13C-L-Lactate	Sigma-Aldrich	Cat# 485926
U-13C-glucose	Cambridge Isotope Laboratory	Cat# CLM-1396-1
U-13C-glutamine	Cambridge Isotope Laboratory	Cat# CLM-1822-H-0.1
U-13C-palmitate	Sigma-Aldrich	Cat# 605751-SPEC
4-(2-Aminoethyl)benzenesulfonyl fluoride hydrochloride	Sigma-Aldrich	Cat# A8456
Phosstop	Sigma-Aldrich	Cat# 4906845001
Nitrocellulose membranes 0.2 μm	Biorad	Cat# 1620150
Recombinant Protein L, biotinylated	Pierce	Cat# 29997
Critical commercial assays
Tumor Dissociation Kit	Miltenyi Biotec	Cat# 130-096-730
Mouse CD8+ T cell enrichment kit	StemCell Technologies	Cat# 19853
Mouse naive CD8+ T cell enrichment kit	StemCell Technologies	Cat# 19858
Mouse CD90.1 Positive Selection Kit	StemCell Technologies	Cat# 18958
Intracellular Fix & Perm Buffer set	eBiosciences	Cat# 88-8824
FoxP3/Transcription factor staining	eBiosciences	Cat# 00-5523
Annexin V - APC Apoptosis Detection Kit	eBioscience	RRID: AB_2575165
SuperScript III First-Strand Synthesis System	ThermoFisher Scientific	Cat# 18080051
KAPA SYBR FAST qPCR Kit Master Mix	Kapabiosystems	Cat# KR0389
Dynabeads Mouse T-Activator CD3/CD28	ThermoFisher Scientific	Cat# 11452D
Dynabeads Human T-Activator CD3/CD28	ThermoFisher Scientific	Cat# 11161D
MinElute PCR Purification kit	QIAGEN	Cat# 28004
CountBright Plus Absolute Counting Beads	ThermoFisher Scientific	Cat# C36995
PureLink HiPure Plasmid Filter Midiprep Kit	ThermoFisher Scientific	Cat# K210014
StraightFrom BuffyCoat REALease CD3 microbeads	Miltenyi	Cat# 130-127-142
BCA Protein Assay Kit	ThermoFisher Scientific	Cat# 10678484
Transposase reaction mix	Illumina	Cat# 20034197
Agencourt AMPure XP magnetic beads	Beckman	Cat# A63880
ECL reagents	Super Signal West, Thermo Scientific	Cat# RPN2235
Femto reagents	Super Signal West, Thermo Scientific	Cat# 34096
Deposited data
ATAC-seq data	This paper	GEO: GSE184718
Raw data and uncropped scans of Western blots	This paper	Data S1
Experimental models: Cell lines
B16-F10 melanoma	American Type Culture Collection	N/A
Phoenix-Eco	American Type Culture Collection	N/A
the human B cell leukemia NALM6	American Type Culture Collection	N/A
Experimental models: Organisms/strains
Mouse: C57BL/6 (B6) (CD45.2)	Charles River	N/A
Mouse: C57BL/6 (B6) (CD45.1)	Janvier	N/A
Mouse: Cd4-Cre (B6.Cg-Tg(Cd4-cre)1Cwi/BfluJ)	Jackson Laboratory	Jax: 22071
Mouse: whole body Cas9 (B6J.129(Cg)- Gt(ROSA)26Sortm1.1(CAG-cas9∗,-EGFP)Fezh/J)	Jackson Laboratory	Jax: 026179
Mouse: B6;129-Gt(ROSA)26Sortm1(CAG-cas9∗,-EGFP)Fezh/J)	Jackson Laboratory	Jax: 024857
Mouse: OT1 C57BL/6-Tg(TcraTcrb)1100Mjb/J	Jackson Laboratory	Jax: 003831
Mouse: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NOD scid g, NSG)	Jackson Laboratory	Jax: 005557
Mouse: Mpc1tm1a(EUCOMM)Wtsi	Gray et al. (2015)	N/A
Oligonucleotides
Runx1 sequence 1	Doench et al. (2016)	CGGTCCCTACACTAGGACAT
Runx1 sequence 2	Doench et al. (2016)	TGCGCACTAGCTCGCCAGGG
Runx1 sequence 3	Doench et al. (2016)	CCAGCGACACCCATTTCACC
Software and algorithms
GraphPad Prism v9	http://graphpad-prism.software.informer.com/5.0/	N/A
FlowJo v10	Tree Star	N/A
ProteoWizard	Kessner et al. (2008)	N/A
OpenMS	Sturm et al. (2008)	N/A
MAVEN	Melamud et al. (2010)	N/A
IsoCor	Millard et al. (2012)	N/A
Cluster 3.0	de Hoon et al. (2004)	N/A
Java Treeview	Saldanha (2004)	N/A
Mascot 2.7	Matrix Science, London, UK	N/A
AdapterRemoval v. 2.1.7	Schubert et al. (2016)	N/A
Bowtie 2 v. 2.3.4.1	Langmead and Salzberg (2012)	N/A
samtools v. 1.8	Li et al. (2009)	N/A
MACS2 v. 2.1.1.20160309	Zhang et al. (2008)	N/A
R v. 3.5.1	https://www.R-project.org/	N/A
DiffBind package v. 2.10.0	Ross-Innes et al. (2012); http://bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf	N/A
ChIPpeakAnno package v. 3.16.1	Zhu et al. (2010)	N/A
Homer software v. 4.11	Heinz et al. (2010)	N/A
BEDtools suite	Quinlan and Hall (2010)	N/A
Jaspar database	http://jaspar.genereg.net/	N/A
FIMO program	Grant et al. (2011)	N/A
MEME suite	https://meme-suite.org/meme/doc/fimo.html?man_type=web	N/A
clusterProfiler package v. 4.0.4	Wu et al. (2021)	N/A