Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-CtIP (Rabbit polyclonal) | N/A | custom made (Richard Baer, Columbia University) | WB (1:1000) |
| Antibody | Anti-MRE11 (Rabbit polyclonal) | Novus Biologicals | NB100-142 RRID:AB_1109376 |
WB (1:2000) |
| Antibody | Anti-GAPDH (GAPDH-71.1) (Mouse monoclonal) | Millipore Sigma | G8795 RRID:AB_1078991 |
WB (1:10000) |
| Antibody | Anti-KAP1 (N3C2) (Rabbit polyclonal) | Genetex | GTX102226 RRID:AB_2037324 |
WB (1:2000) |
| Antibody | Anti-RPA32 (4E4) (Rat monoclonal) | Cell Signaling Technology | 2,208 S RRID:AB_2238543 |
WB (1:1000) FC (1:200) IF (1:500) |
| Antibody | Anti-KU70 (D10A7) (Rabbit monoclonal) | Cell Signaling Technology | 4,588 S RRID:AB_11179211 |
WB (1:1000) |
| Antibody | Anti-DNA-PK (SC57-08) (Rabbit monoclonal) | Invitrogen | MA5-32192 RRID:AB_2809479 |
WB (1:1000) |
| Antibody | Anti-RPA32 (rabbit polyclonal) |
Abcam | ab10359 RRID:AB_297095 | ChIP (10 ug) |
| Antibody | HRP, goat anti-mouse (goat polyclonal) | Promega | W4021 RRID:AB_430834 |
WB (1:5000) |
| Antibody | HRP, goat anti-rabbit IgG (goat polyclonal) | Promega | W4011 RRID:AB_430833 |
WB (1:5000) |
| Antibody | Alexa Fluor 488, goat anti-rat IgG (goat polyclonal) | BioLegend | 405,418 RRID:AB_2563120 |
FC (1:500) |
| Antibody | Alexa Fluor 647, goat anti-rat IgG (goat polyclonal) | BioLegend | 405,416 RRID:AB_2562967 |
FC (1:500) |
| Antibody | Alexa Fluor 594, goat anti-rat IgG (goat polyclonal) | BioLegend | 405,422 RRID:AB_2563301 |
IF (1:500) |
| Recombinant DNA reagent | pCW-Cas9 (plasmid) | Addgene | 50,661 RRID:Addgene_50661 |
|
| Recombinant DNA reagent | pKLV-U6 gRNA(BbsI)-PGKpuro-2ABFP (plasmid) | Addgene | 50,946 RRID:Addgene_50946 |
|
| Recombinant DNA reagent | Genome-wide CRISPR guide RNA library V2 (plasmid) | Addgene | 67,988 RRID:Addgene_67988 |
|
| Cell line (H. sapiens) | MCF10A | ATCC | CRL-10317 RRID:CVCL_0598 |
|
| Cell line (H. sapiens) | MCF10A: iCas9 | This study | Clone 25 | Available upon request |
| Cell line (M. musculus) | WT:iCas9 abl pre-B cells | This study | M63.1.MG36.iCas9.302 | Available upon request |
| Cell line (M. musculus) | Lig4-/-:iCas9 abl pre-B cells | This study | A5.83.MG9.iCas9.16 | Available upon request |
| Cell line (M. musculus) | Lig4-/-:iCas9 abl pre-B cells | This study | A5.115.iCas9.72 | Available upon request |
| Cell line (M musculus) | Lig4-/-:Trp53bp1:iCas9 abl pre-B cells | This study | Clone 82 | Available upon request |
| Cell line (M musculus) | Lig4-/-:Xrcc6-/-:iCas9 abl pre-B cells | This study | Clones 134 and 140 | Available upon request |
| Cell line (M. musculus) | Lig4-/-:Prkdc-/-:iCas9 abl pre-B cells | This study | Clone 6 | Available upon request |
| Cell line (M. musculus) | Lig4-/-:Fbxl12-/-:iCas9 abl pre-B cells | This study | Clone 6 | Available upon request |
| Cell line (M. musculus) | Lig4-/-:iAsiSI abl pre-B cells | This study | Clone 20 | Available upon request |
| Chemical compound, drug | Imatinib | Selleckchem | S2475 | |
| Chemical compound, drug | Doxycycline | Sigma-Aldrich | D9891 | |
| Chemical compound, drug | Polybrene | Sigma Aldrich | S2667 | |
| Chemical compound, drug | Lipofectamine 2000 | Thermo Fisher Scientific | 11668019 | |
| Chemical compound, drug | NU7441 | Selleck Chemicals | S2638 | |
| Chemical compound, drug | KU-55933 | Selleck Chemicals | S1092 | |
| Chemical compound, drug | EGF | PeproTech | AF-100–15 | |
| Chemical compound, drug | Hydrocortisone | Sigma-Aldrich | H-0888 | |
| Chemical compound, drug | Cholera Toxin | Sigma-Aldrich | C-8052 | |
| Chemical compound, drug | Insulin | Sigma-Aldrich | I-1882 | |
| Commercial assay, kit | 7-AAD (DNA stain) | BD Biosciences | 559,925 RRID:AB_2869266 |
|
| Commercial assay, kit | Cytofix/Cytoperm solution | BD Biosciences | 554,722 RRID:AB_2869010 |
|
| Commercial assay, kit | Perm/Wash Buffer | BD Biosciences | 554,723 RRID:AB_2869011 |
|
| Commercial assay, kit | FITC BrdU Flow Kit | BD Biosciences | 559,619 RRID:AB_2617060 |
|
| Sequence-based reagent | pKLV lib330F | This study designed based on [Tzelepis et al., 2016] | PCR primers | AATGGACTATCATATGCTTACCGT |
| Sequence-based reagent | pKLV lib490R | This study designed based on Tzelepis et al., 2016 | PCR primers | CCTACCGGTGGATGTGGAATG |
| Sequence-based reagent | PE.P5_pKLV lib195 Fwd | This study designed based on Tzelepis et al., 2016 and standard Illumina adaptor sequences | PCR primers | AATGATACGGCGACCACCGAGATCTGG CTTTATATATCTTGTGGAAAGGAC |
| Sequence-based reagent | P7 index180 Rev | This study designed based on Tzelepis et al., 2016 and standard Illumina adaptor sequences | PCR primers | CAAGCAGAAGACGGCATACGAGAT INDEXGTGACTGGAGTTCAGACGTG TGCTCTTCCGATCCAGACTGCCTTGGGAAAAGC |
| Sequence-based reagent | BU1 | Canela et al., 2016 | PCR primers | 5′-Phos-GATCGGAAGAGCGTCGT GTAGGGAAAGAGTGUU[Biotin-dT]U [Biotin-dT]UUACACTCTTTC CCTACA CGACGCTCTTCCGATC* T-3′ [*phosphorothioate bond] |
| Sequence-based reagent | BU2 | Canela et al., 2016 | PCR primers | 5′-Phos-GATCGGAAGAGCACACG TCUUUUUUUUAGACGTGTGCTC TTCCGATC*T-3′ [*phosphorothioate bond] |
| Sequence-based reagent | Trp53bp1 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | GAACCTGTCAGACCCGATC |
| Sequence-based reagent | Rbbp8 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | ATTAACCGGCTACGAAAGA |
| Sequence-based reagent | Mre11 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | TGCCGTGGATACTAAATAC |
| Sequence-based reagent | Prkdc gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | ATGCGTCTTAGGTGATCGA |
| Sequence-based reagent | Xrcc6 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | CCGAGACACGGTTGGCCAT |
| Sequence-based reagent | Fbxl12 gRNA sequence | Sequence is from Tzelepis et al., 2016 | N/A | TTCGCGATGAGCATCTGCA |
| Software, algorithm | Image J | NIH | RRID:SCR_003070 | |
| Software, algorithm | FlowJo | FlowJo | RRID:SCR_008520 | |
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | Gen5 | Biotek Instruments | RRID:SCR_017317 | |
| Software, algorithm | SeqKit | Shen et al., 2016 | RRID:SCR_018926 | |
| Software, algorithm | Bowtie | Langmead et al., 2009 | RRID:SCR_005476 | |
| Software, algorithm | SAMtools | Li et al., 2009 | RRID:SCR_002105 | |
| Software, algorithm | BEDtools | Quinlan and Hall, 2010 | RRID:SCR_006646 | |
| Other | LSRII Flow cytometer | BD Bioscience | RRID:SCR_002159 | Flow cytometer |
| Other | FACS Celesta Flow Cytometer | BD Bioscience | RRID:SCR_019597 | Flow cytometer |
| Other | FACSAria II Cell Sorter | BD Bioscience | RRID:SCR_018934 | Flow assisted cell sorter |
| Other | Lionheart LX automated microscope | BioTex Instruments | RRID:SCR_019745 | Automated microscope |
| Other | 4-D Amaxa Nucleofecter | Lonza | NA | Nucleofector |