Skip to main content
. 1999 May;65(5):1849–1853. doi: 10.1128/aem.65.5.1849-1853.1999

TABLE 2.

Expression of cry1-lacZ fusions in various B. thuringiensis subspecies

lacZ fusion Sp act of β-galactosidase ina:
Strain 80-21 Strain 5 Strain HD124-12 Strain HD112
cry1Ab 39.0 11.0 36.0 10.0
cry1Cc 30.0 26.0 NDe ND
Bendd 31.0 32.0 ND  19.0
IRd 30.0 29.0 ND  ND
cry1A promoters only 8.0 7.5 ND  ND
a

Average values expressed as the maximum number of Miller units per unit of absorbance at 600 nm at the end of growth; the coefficients of variation were less than ± 10%. The values for strains 80-21 and 5 are the values obtained for the original transformants with plasmids isolated from E. coli. The lacZ fusion plasmid from strain 5 was electroporated into HD124-12. This plasmid and the other plasmids were also reintroduced into strain 80-21, and the plasmids from strain 80-21 were electroporated into strain 5. 

b

A 280-bp region upstream of the promoters was ligated to the cry1A-272–lacZ fusion (29). 

c

A 780-bp region upstream of the cry1C promoters was ligated to the cry1A-272–lacZ fusion. 

d

The 280-bp cry1A upstream region was ligated to cry1A-272–lacZ, but the potential bend or IR region was mutated (Fig. 1) (32). The bend mutation (Fig. 1, boldface region) involved changes in 5′CTCAGTCTGTCTATGTAGAACAGGACAAGTG (changes in boldface type). The IR was mutated to 5′CCTGCAGTTAAGCCTGAATTGTAAATGC. 

e

ND, not determined.