REAGENT or RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins
Recombinant Ribonuclease Inhibitor (RNase Inhibitor)	Takara/Clontech	2313A
10 mM dNTP Mix	Thermo Fisher Scientific	R0193
USB Dithiothreitol (DTT), 100 mM	Thermo Fisher Scientific	707265ML
MgCl2	MilliporeSigma	63069
Low TE Buffer (10 mM Tris-HCl pH 8.0, 0.1 mM EDTA)	Thermo Fisher Scientific	12090-015
5 M Betaine Solution	MilliporeSigma	B0300
Lambda Exonuclease	New England BioLabs	M0262
AMPure XP Beads	Beckman Coulter	A63881
TAPS (3-(Tris(hydroxymethyl) methylamino) propane-1-sulfonic acid) free acid ≥99%, high purity.	VWR	97064-208
Tn5	Picelli et al. (2014) or Nextera XT DNA Sample Preparation Kit	n/a
Buffer EB	QIAGEN	19086
50× Protease Inhibitor Cocktail	Promega	G6521
RNasin Plus Ribonuclease Inhibitor	Promega	N2615
Critical commercial assays
KAPA HiFi HotStart ReadyMix	Roche	KK2602
ERCC Spike-In Mixture	Thermo Fisher Scientific	4456740
Nextera XT DNA Sample Preparation Kit	Illumina	FC-131-1096
Smartscribe Reverse Transcriptase	Clontech/Takara	639538
Chromium Next GEM Single Cell 3′ GEM, Library & Gel Bead Kit v3.1	10× Genomics	1000128
Chromium Next GEM Chip G Single Cell Kit	10× Genomics	1000120
Single Index Kit T Set A, 96 rxn	10× Genomics	1000213
KAPA HiFi PCR Kit	Roche	7958838001
High Sensitivity D5000 Reagents	Agilent Technologies	5067–5593
Experimental models: Organisms/strains
UAS-Lam-GFP (D. melanogaster)	Bloomington Drosophila Stock Center	BDSC_97378
UAS-unc84-GFP (D. melanogaster)	Henry et al. (2012)	n/a
Oligonucleotides
IS PCR primer: AAGCAGTGGTATCAACGCAGAGT	Picelli et al. (2014)	n/a
Oligo-dT30VN: AAGCAGTGGTATCAACGCAGAG TACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN	Picelli et al. (2014)	n/a
xGen™ 10nt UDI Primers	Integrated DNA Technologies	10008055 10008056 10008057
TSO: AAGCAGTGGTATCAACGCAGAGTACAT rGrG+G (‘rG’=riboguanosine; ‘+G’= LNA-modified guanosine)	Exiqon; Picelli et al. (2014)	n/a
Other
Adhesive PCR Plate Foil Seals	Bio-Rad	MSF1001
Adhesive PCR Plate Seals	ThermoFisher	AB0558
DNA LoBind Tubes (1.5 mL)	Eppendorf	022431021
DynaMag-2 Magnetic Rack	Fisher Scientific	12-321-D
Falcon 5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap	Corning	352235
FLOWMI 40 μM Cell Strainers	Bel-Art	H13680-0040
Hard-Shell PCR Plates (384-well)	Bio-Rad	HSP3481
Hard-Shell PCR Plates (96-well)	Bio-Rad	HSP9631
Kimble Pellet Pestle	Grainger	6HAY5
Kimble Pellet Pestle Motor	Grainger	6HAZ6
Three-well spot plate	Electron Microscopy Sciences	71574-05
Wheaton Dounce Tissue Grinder (1 mL)	DWK Life Sciences	357538
High Sensitivity D5000 Ladder	Agilent Technologies	5067–5594
High Sensitivity D5000 ScreenTape	Agilent Technologies	5067–5592
Hoechst-33342	ThermoFisher	H3570
Beckman Coulter SPRIselect	Beckman Coulter	B23318
C-Chip™ Disposable Hemacytometers by SKC, Inc	Fisher Scientific	22-600-100