Table 5.
Description of the insertions, deletions, or combinations of both, identified by cloning/sequencing analysis in the 4 patients selected.
| Patient (N Clones Analyzed) |
Deletions | Insertions | N Clones (%) | ID | N Reads (%) |
|---|---|---|---|---|---|
| 2 (24) | 1627 + 1758 − 1777 | 1647 TCTTACATAAGAGGACTCTTGGAC | 12 (50) | 12 | 9554 (51.9) |
| - | 1820 C | 1 (4.2) | 74 | 75 (0.4) | |
| 1627 + 1726 + 1758 − 1777 | 1647 TCTTACATAAGAGGACTCTTGGAC | 2 (8) | - | - | |
| 1627 + 1758 − 1777 | 1647 TCTTACATAAGAGGACTCTTGGAC + 1822 ATTCAA + 1825 T | 1 (4.2) | - | - | |
| 1627 | 1600T + 1647 TCTTACATAAGAGGACTCTTGGAC | 1 (4.2) | - | - | |
| - | - | 7 (29.2) | - | 4692 (25.5) | |
| 17 (29) | - | 1825 T | 2 (6.9) | 84 | 3140 (14.2) |
| - | 1909 TG | 1 (3.4) | * | * | |
| - | - | 26 (89.7) | - | 18736 (84.8) | |
| 20 (18) | 1825 | - | 1 (5.6) | 85 | 3011 (15.5) |
| - | 1826 TTC | 6 (33.3) | 89 | 2171 (11.2) | |
| - | - | 11 (61) | - | 14064 (72.5) | |
| 39 (19) | - | 1605 T | 1 (5.3) | - | - |
| - | 1825 T | 7 (36.8) | 84 | 3242 (22.9) | |
| - | 1895 T | 1 (5.3) | * | * | |
| - | - | 10 (52.6) | - | 9701 (68.5) |
Abbreviations: N Clones indicates number of clones showing a specific insertion, deletion or combination of both; ID, code to designate single insertion or deletion, or combinations of them identified by next-generation sequencing (see Table S3); N Reads, number of next-generation sequencing reads showing a specific single insertion or deletion, or a combination of both. * Insertions that have not been assessed in next-generation sequencing reads since they are located out of hepatitis B X gene open reading frame.