Abstract
Foot rot disease caused by Phytophthora capsici is a serious threat to black pepper cultivation in India and globally. High diversity exists among the Phytophthora isolates of black pepper and hence detailed investigations of their morphology and phylogenetic taxonomy were carried out in the present study. In order to resolve the diversity, 182 isolates of Phytophthora, collected from different black pepper-growing tracts of South India during 1998–2013 and maintained in the National Repository of Phytophthora at ICAR-Indian Institute of Spices Research, Kozhikode, were subjected to morphological, molecular and phylogenetic characterization. Morphologically all the isolates were long pedicellate with umbellate/simple sympodial sporangiophores and papillate sporangia with l/b ranging from 1.63 to 2.55 µm. Maximum temperature for the growth was ~ 34 °C. Chlamydospores were observed in “tropicalis” group, whereas they were absent in “capsici” group. Initial molecular studies using internal transcribed spacer (ITS) marker gene showed two clear cut lineages—“capsici-like” and “tropicalis-like” groups among them. Representative isolates from each group were subjected to host differential test, multilocus sequence typing (MLST) and phylogeny studies. MLST analysis of seven nuclear genes (60S ribosomal protein L10, beta-tubulin, elongation factor 1 alpha, enolase, heat shock protein 90, 28S ribosomal DNA and TigA gene fusion protein) clearly delineated black pepper Phytophthora isolates into two distinct species—P. capsici and P. tropicalis. On comparing with type strains from ATCC, it was found that the type strains of P. capsici and P. tropicalis differed from black pepper isolates in their infectivity on black pepper. The high degree of genetic polymorphism observed in black pepper Phytophthora isolates is an indication of the selection pressure they are subjected to in the complex habitat which ultimately may lead to speciation. So based on the extensive analysis, it is unambiguously proved that the foot rot disease of black pepper in India is predominantly caused by two species of Phytophthora, viz. P. capsici and P. tropicalis. Presence of multiple species of Phytophthora in the black pepper agro-ecosystem warrants a revisit to the control strategy being adopted for managing this serious disease. The silent molecular evolution taking place in such an ecological niche needs to be critically studied for the sustainable management of foot rot disease.
Supplementary Information
The online version contains supplementary material available at 10.1007/s42770-022-00716-2.
Keywords: Black pepper, Foot rot disease, Genetic diversity, Hybrid analysis, MLST, Phytophthora capsici, Phytophthora tropicalis, Piper nigrum
Introduction
Foot rot caused by Phytophthora spp. is a devastating disease and a major production constraint to black pepper cultivation wherever it is grown. Black pepper is cultivated as a monocarp in Brazil, Indonesia, Malaysia and Vietnam while in India it is mostly cultivated as an intercrop crop along with cardamom, coffee, coconut, arecanut, tea and etc. Several of these companion crops are susceptible to infection by Phytophthora and in such a mixed/intercropping system, there is a high possibility of cross infection that facilitates perpetuation and spread of Phytophthora [1]. Phytophthora species responds differently to varying management strategies and apart from that, inter-specific hybridizations have also been reported in Phytophthora and the recombinant progeny may vary in their morphological characters and can be more virulent than the parents [2].
Phytophthora infecting black pepper was originally reported as P. palmivora [3] later renamed as P. palmivora MF4 and further revised as P. capsici [4]. According to Holliday [5], the species that infect Piper was designated as P. capsici f. sp. piperis but later it was elevated into a new species named P. tropicalis [4]. In a study on genetic and morphological diversity of tropical and temperate isolates of P. capsici, researchers were of the opinion that since worldwide data are incomplete and insufficient to separate tropical and temperate isolates into different species, they refrained from using the epithet P. tropicalis to the sub group of P. capsici [3]. Phytophthora capsici was first described in New Mexico in 1922 as the causal agent of chilli pepper blight (Capsicum annuum L.) [4]. It is heterothallic and requires both A1 and A2 mating types for sexual reproduction. Many researchers reported the occurrence of both A1 and A2 types of P. capsici from the same field and also on the same host plant [6–8].
Furthermore, there are conflicting reports on chlamydospore production by Phytophthora isolates infecting black pepper [9–11]. According to Tsao and Alizadeh [12], the isolates of MF4 from cacao, black pepper and etc. that formed chlamydospores are P. capsici in the amended description of the species. Uchida and Aragaki [11] indicated that the chlamydospore-producing isolates that are pathogenic to tropical crops but non-pathogenic to pepper are distinct from P. capsici. Many other researchers reported diversity existing among P. capsici isolates. Oudemans and Coffey [10] did isozyme analysis and noticed three different loci among the P. capsici isolates and separated them into three groups, viz. CAP1, CAP2 and CAP3 and the isolates that deviate from the typical P. capsici were placed in CAP2 and CAP3. Mchau and Coffey [13] also identified two distinct subgroups, CapA and Cap B, among P. capsici isolates, collected from different countries including India, based on isozyme analysis. These reports clearly emphasized the diversity/deviations of P. capsici from original descriptions. Recently, our own preliminary studies [14, 15] also indicated such deviations in black pepper Phytophthora isolates from India.
Molecular tools like RAPD, RFLP, rDNA-ITS sequencing, multilocus sequence typing (MLST) and phylogenetic analysis have become important to study genetic variability in plant-pathogen populations [16]. With the addition of several new species in the last decade, several attempts were made to delineate the phylogeny of Phytophthora by undertaking comprehensive MLST studies using populations across the globe [17–19]. However, in none of these studies, Indian populations were used. Therefore, a thorough investigation by employing different molecular analysis was undertaken to understand the species complexity in Phytophthora isolates infecting black pepper in India. A clear understanding of the genetic diversity in the Phytophthora infesting black pepper is highly essential to evolve effective and durable control measures for sustainable management of this key disease causing havocs in all the pepper-growing countries.
Materials and methods
Phytophthora cultures
The details of Phytophthora isolates used in this study are given in Supplementary Table 1. This includes 182 isolates of Phytophthora, collected from black pepper-growing tracts of three southern states of India, viz. Kerala, Karnataka and Tamil Nadu. They were isolated during 1998–2013 and are being maintained in the National Repository of Phytophthora at ICAR-Indian Institute of Spices Research, Kozhikode, Kerala.
Morphological characterization
Phytophthora isolates retrieved from the repository were purified by growing in carrot agar (CA) medium (supplemented with PVPH [20]) for 72 h at 24 ± 1℃. Mycelial plugs of 5 mm size, cut from the growing margins of the pure cultures, were further inoculated on to CA at 24 ± 1℃ for 72 h and colony morphology of 128 isolates was documented.
Sporangial morphology
Mycelial plugs of 5 mm size were transferred to Petri plates containing sterile distilled water and incubated under white fluorescent light for 48 h [9]. The ontogeny, caducity and shape of sporangia were recorded; pedicel length, length and breadth of sporangia were measured and their l/b ratio was calculated.
Chlamydospore production
Mycelial plugs of 5 mm size were cut out from the margins of 72-h-old pure culture of each isolate and inoculated on CA slants. These slants were allowed to grow in light for 5 days and then transferred to a BOD incubator set at 15℃ and incubated for 2 months. After 2 months, the cultures were examined for the production of chlamydospores.
Differential host reaction
A total of 18 Phytophthora isolates representing different states of South India were used for the study (Supplementary Table 2). The isolates were selected primarily based on geographical regions of origin, time span of collection (before 2000, 2000 to 2010 and after 2010) and plant parts/substrates from which the cultures were isolated (spike, leaf, stem, root and soil). Two type cultures of P. capsici (ATCC 4034) and P. tropicalis (ATCC 76,651) were also obtained from ATCC and included in the present study for comparative analyses.
The differential reaction of Phytophthora isolates was studied on black pepper (variety: Sreekara) and pothos (a known host of P. tropicalis). The rooted cuttings of black pepper raised by serpentine method and pothos were transplanted to polythene bags (21 × 15 cm dimension) and 4–5 leaf stage plants were used for inoculation. The inoculation studies were performed during 2016 south-west monsoon period (June–August) in which the inoculation was performed on five plants per isolate. The selected Phytophthora isolates were cultured on CA medium and incubated for 72 h. Mycelial plugs of 3 mm size were derived from the advanced margins of the actively growing 72-h-old cultures. Second and third fully opened leaves of black pepper as well as pothos were used for inoculation. The mycelial plug was placed on the abaxial surface of the leaves (without injury) and sterile wet cotton pad was placed over the inoculum in order to maintain adequate moisture to facilitate infection process and kept intact by wrapping with a polythene strip. The inoculated plants were maintained for 72 h at a temperature of 24–25℃ with relative humidity of 80–90% (ambient weather conditions) after which the observations were recorded [21, 22].
Molecular characterization
ITS-rDNA sequencing
To study the diversity, the 155 Phytophthora isolates were subjected to ITS-rDNA sequencing. To extract DNA, the isolates were grown in Ribeiro’s liquid medium [23] and grown at 24 ± 1℃ for 5–6 days. DNA was isolated following the method described by Sheji et al. [24] and the ITS-rDNA region was amplified using the universal primers ITS-6 and ITS-4 [25, 26]. Amplification was performed in a programmable thermal cycler (Master Cycler Gradient, Eppendorf, Germany). All the isolates showed an expected amplicon of 900 bp. Elution and purification of the amplified products from 1.0% agarose gel were carried out using GenElute Gel Extraction Kit (Sigma-Aldrich, Bangalore, India) according to the manufacturer’s instructions and were custom sequenced at Xcelris Labs Pvt. Ltd. Bengaluru. The sequence data of these amplified fragments were obtained using ABI DNA sequencer. The sequences were edited and subjected to similarity search in the IDphy database (http://idtools.org/id/phytophthora/molecular.php) as per the protocol suggested [27].
ITS-RFLP profiling
In silico ITS-RFLP analysis was performed with the ITS sequences of 108 Phytophthora isolates using three restriction enzymes, viz. MspI, AciI and Alu I. Among the enzyme sites, MspI showed distinct groupings similar to that of ITS profiling. Further 11 Phytophthora isolates were selected for wet lab analysis based on in silico RFLP analysis along with known Phytophthora species from citrus (P. citrophthora), coconut (P. palmivora) and cardamom (P. nicotianae). ITS-PCR products were digested with the restriction enzyme MspI [6] by following the manufacturer’s instructions. The reaction mixture consisted of 10 µl PCR product (~ 0.1 to 0.5 µg of DNA), 2 µl 10X reaction buffer, 18 µl nuclease free water and 0.5 µl MspI (10 U/µl). The reaction mixture was mixed gently and incubated at 37℃ for 1 h. After incubation, the restriction digestion was stopped by thermal inactivation at 80℃ for 20 min. The restricted products were separated in 3% agarose gels along with 100 bp ladder (Fermentas, Vilnius, Lithuania) at 70 V for 1 h and documented. The RFLP gel images were analysed using Gel Analyzer (version 2010a, freeware) to obtain the band size of the fragments.
Single-stranded conformation polymorphism analysis
Single-stranded conformation polymorphism (SSCP) analysis is a powerful tool, which can detect single base mutations or variations [28, 29]. Thirty-one black pepper isolates, one P. capsici isolate from coconut and two P. tropicalis isolates from nutmeg were used for this study (see Fig. 4 for details). DNA amplification and SSCP analysis of the PCR products were performed as described previously [28]. For amplification, a pair of primers that favour oomycetes was used [25]—forward primer ITS6: 5′-GAA GGT GAA GTC GTA ACA AGG-3′, located in the 18S rDNA and reverse primer ITS7: 5′-AGCGTT CTT CAT CGA TGT GC-3′, located in the 5.8S rDNA. PCR was performed in a total volume of 25 µl containing 100 ng of DNA. The PCR conditions were as mentioned in section.
Fig. 4.

ITS-RFLP using Msp1—ITS-RFLP pattern of Phytophthora isolates from black pepper. M: 100 bp ladder; lanes 1 and 2: “capsici-like” group; lanes 3, 4, 6 and 7: “tropicalis-like” group, lane 5: P. citrophthora, lanes 8 and 9: P. palmivora and lanes 10 and 11: P. nicotianae
One microlitre of individual PCR products was mixed with 9 ml of the denaturing buffer (95% formamide, 20 mM EDTA and 0Æ05% bromophenol blue). After a brief spin, mixtures were heated at 96 °C for 10 min then chilled on ice. Five microlitres of each mixture was loaded on an 8% acrylamide:Bis acrylamide (29:1) nondenaturing minigel cast using a Mini-PROTEAN 3 Cell (BioRad Laboratories, Hercules, CA, USA). An aliquot of 25 ng of a single-stranded DNA (ssDNA) ladder also was included to facilitate comparison of SSCP patterns [28]. Denatured PCR products were eletrophoresed in prechilled 1X TBE buffer at 200 V for 2 h at room temperature. After electrophoresis, the gel was subjected to silver staining. SSCP banding patterns of individual isolates were analysed with the aid of the ssDNA ladder.
Multilocus sequence typing analysis
The ITS-rDNA and ITS-RFLP analysis of Phytophthora isolates from black pepper revealed the existence of two distinct groups. To confirm the diversity existing among Phytophthora isolates, six each highly virulent representative isolates were selected from each group (“capsici-like” group I: 01–03, 05–05, 05–06, 06–04, 09–01 and 10–02 and “tropicalis-like” group II: 11–27, 11–29, 98–02, 98–03, 98–07 and 98–93) and seven genetic markers, viz. 60S ribosomal protein L10 (60S), beta-tubulin (ß-tub), elongation factor 1 alpha (EF1α), enolase (Enl), heat shock protein 90 (HSP90), 28S ribosomal DNA (28S) and TigA gene fusion protein (TigA), were amplified using specific markers listed in Table 1 [17, 18]. The PCR conditions were standardized by adjusting the annealing temperature using a gradient PCR. All the reactions were carried out in a total volume of 25 µl consisting of 0.4 µM primers, 50 ng DNA, 0.1 mM dNTPs, 1.5 mM and 0.02 U Taq DNA polymerase.
Table 1.
Standardized temperature and amplicon size of selected primers used for amplifying various marker genes in Phytophthora isolates infecting black pepper
| Gene | Primer set | Sequence | Annealing temperature (°C) | Amplicon size (bp) |
|---|---|---|---|---|
| 28S ribosomal DNA | LROR-O | ACCCGCTGAACTYAAGC | 53 | ~ 1300 |
| LR6-O | CGCCAGACGAGCTTACC | |||
| 60S ribosomal protein L10 | 60SL10_for | GCTAAGTGTTACCGTTTCCAG | 60 | ~ 500 |
| 60SL10_rev | ACTTCTTGGAGCCCAGCAC | |||
| Beta-tubulin | Btub_F2 | CGGTAACAACTGGGCCAAGG | 60 | ~ 750 |
| Btub_R2 | GATCCACTCAACGAAGTACG | |||
| Elongation factor 1 α | EF1A_FL | GGTCACCTGATCTACAAGTGC | 60 | ~ 1200 |
| EF1A_RL | CCTTCTTGTTCACCGACTTG | |||
| Enolase | Enl_for | CTTTGACTCGCGTGGCAAC | 60 | ~ 1300 |
| Enl_rv | CCTCCTCAATACGMAGAAGC | |||
| Heat shock protein 90 | HSP90_F3 | ACGCCTCGTTCTACAAGTCG | 62 | ~ 1100 |
| HSP90_R2 | CGTGTCGTACAGCAGCCAGA | |||
| TigA gene fusion protein | G3PDH_for | TCGCYATCAACGGMTTCGG | 66 | ~ 1000 |
| G3PDH_rev | GCCCCACTCRTTGTCRTACCAC |
The PCR products for each gene were eluted and directly sent for sequencing. In case of direct sequencing failures, the purified PCR products were cloned to pTZ57R/T vector and transformed into competent E. coli strain DH5α using InsTAclone PCR cloning kit (Thermo Scientific, USA). Plasmid DNA isolated from the positive clones was then sent for sequencing. The sequence data was assembled using DNA baser V3.5.4. Similarity searches were done using BLASTn programme of NCBI.
For Cox1 gene, PCR assay was carried out to amplify approximately 1160 bp region of Phytophthora isolates, viz., group I (05–06, 01–03, 06–09, 99–162) and group II (98–93, 97–55, 11–27, 11–29, 98–02) and ATCC type cultures of P. capsici (ATCC4034) and P. tropicalis (ATCC76651) using primers FM 84 (5′-TTTAATTTTTAGTGCTTTTGC-3′) and FM83 (5′-CTCCAATAAAAAATAACCAAAAATG-3′). Briefly 20 µl PCR reaction mixture was prepared with 0.5 µl of dNTP mix, 2 µl of Taq buffer, 0.3 µl of Taq polymerase, 0.5 µl of forward and reverse primer, 1.0 µl of genomic DNA (approx. 100 ng) and 15.2 µl of nuclease free water. PCR was performed with initial denaturation at 94℃ for 5 min, followed by 35 cycles of denaturation at 94℃ for 1 min, primer annealing at 53℃ for 1 min, extension at 72℃ for 1 min 30 s and a final extension at 72℃ for 10 min. Purified Cox1 PCR product was sequenced and the nucleotide sequence obtained was used in blast analysis to identify similar sequences from NCBI.
Phylogenetic analysis
Phylogenetic analysis of the 12 black pepper isolates (six representative isolates from each group as described above) was done using the seven genetic markers (60S, ß-tub, EF1α, Enl, HSP90, 28S and TigA) and by comparing with 86 Phytophthora isolates (extypes) belonging to subclades 1 (4 isolates), 2a (20 isolates), 2b (14 isolates), 2c (23 isolates), 2d (9 isolates), 2e (3 isolates) and 4 (13 isolates) representing both described and provisionally named species and one isolate each of Pythium undulatum, Halophytophthora fluviatilis and Pythium vexans as outgroup taxa as done by Yang et al. [19] (Supplementary Table 3). The subclades were chosen to include all the Phytophthora species encountered in black pepper rhizosphere. Failure to obtain sequences occurred for only one isolate P. sp. P6262 for TigA gene and enolase genes for outgroups Pythium undulatum and Phytopythium vexans. Phylogenetic analysis for cox1 gene was carried out separately using the Cox1 sequences of 20 isolates from black pepper along with extypes belonging to various species, viz. 4 each isolates of P. capsici and P. tropicalis including ATCC type strains, one each isolates of P. meadii and P. mexicana, 2 each isolates belonging to P. citricola, P. citrophthora, P. sojae, P. oleae, P. palmivora, P. ramorum, P. nicotianae, P. megasperma and P. infestans retrieved from NCBI (Supplementary Table 4). Pythium aphanidermatum (AY564163) was used as the outgroup.
Briefly, the sequences for the isolates were retrieved from NCBI and concatenated with sequences from IISR black pepper Phytophthora strains in Geneious R7. The concatenated sequences of each isolate with all primers for individual genetic markers were then aligned with Clustal X version 2.1 [30] and edited manually to correct obvious sequencing errors and code ambiguous sites to produce a consensus sequence. The alignment was edited in BioEdit version 7.2.5 [31] to trim aligned concatenated sequences to an equal size and set missing data to question marks. The edited alignment was then analysed in jModelTest version 2.1.7 [32] to select the most appropriate model for the phylogenetic analyses. Phylogeny reconstructions including individual marker trees and a concatenated-sequence tree were carried out using both maximum likelihood (ML) and neighbour-joining (NJ) methods with the K2P model and 1000 bootstrap replications in MEGA 7. Bayesian analyses (BA) were performed with MrBayes version 3.2.6 [33] for five million generations with GTR + I + G model. The standard deviation of the split frequencies was 0.00785. Phylogenetic trees constructed were viewed and edited in FigTree version 1.4.2.
Results
Morphology
Morphological observations revealed that the asexual phase of all the isolates is either papillate or semipaillate with different sporangial shapes. All the isolates were caducous with either medium (5–20 μm) or long (> 20 μm) pedicel lengths. However, their sporangial morphology varied widely and did not exhibit any internal proliferation. Out of the 128 isolates studied, 77 isolates did not produce chlamydospores while the rest 51 isolates did produce them (Table 2). The chlamydospores, when present, were terminal and varied in their shape and distribution. The sporangiophores were either umbellate or simple sympodial in nature. The sexual phase of all the isolates was heterothallic and the oogonium smooth walled. The colony morphology in CA varied widely from cottony/stellate/petalloid/chrysanthemum in both groups (Fig. 1). In view of these observations, the isolates were tentatively grouped first into two groups based on the presence or absence of chlamydospores and subsequently based on their pedicel length, sporangiophore morphology and sporangia papillation. The first group (“capsici-like”) that did not produce chlamydospores and had long pedicels but varied in their sporangial papillation and sporangiophore shape resembled P. capsici (Fig. 2). The second group (“tropicalis-like”) having chlamydospores, medium or long pedicels and papillate sporangia has more similarity to P. tropicalis (Fig. 2). However, in both the groups, deviants from the common pattern were observed which need confirmation through molecular investigations.
Table 2.
Morphological characterization of Phytophthora isolates infecting black pepper
| Chlamydospores | Pedicel | Sporangiophore | Papillae | Colony pattern | |||
|---|---|---|---|---|---|---|---|
| Chrysanthemum | Stellate | Petalloid | Cottony | ||||
|
Absent (n = 77) |
Long | Umbellate | Papillate | 00–42, 00–47, 03–10, 05–06,05–13, 05–20, 06–09, 06–11, 07–01, 09–01, 09–03, 09–06, 09–07, 09–13, 09–16, 09–19, 09–20, 09–21, 09–38, 97–52, 98–81, 98–87, 98–164,98–176, 98–183, 98–198, 99–144,99–145, 99–162, 99–166 | 03–08, 05–14, 05–15, 05–16, 07–06 | 01–20, 03–02, 05–05,05–19, 06–01, 06–02, 06–04, 06–10, 07–03, 07–05, 07–07, 07–08, 09–02, 09–08, 09–42, 10–01, 10–02, 10–03, 10–04, 10–05, 98–165, 98–172, 98–174, 98–182 | 01–04, 05–03, 06–03, 08–01, 96–18, 98–50, 98–76, 98–171 |
| Semipapillate | 07–02 | 05–09, 09–33, 98–48, 98–49 | 10–06 | - | |||
| Sympodial | Papillate | 11–27, 98–192 | - | - | 08–04, 08–05 | ||
|
Present (n = 51) |
Medium | Sympodial | Papillate | - | 98–01 | - | |
| Long | Umbellate | Papillate | 01–03, 08–03, 08–07, 09–25, 09–27, 09–28, 09–35,09–36, 09–37, 09–40, 09–41, 11–29, 97–19, 97–55, 98–03, 98–135, 98–142, 98–143, 98–149, 98–157, 99–91, 99–124, 99–139 | 03–03, 06–08, 98–65, 98–74, 98–177, 99–132 | 96–08, 96–09, 97–52, 98–03, 98–59, 98–60,98–70, 98–76, 98–128,98–135, 99–136 | 00–38, 09–11, 09–39, 96–02, 97–11, 98–17, 98–75, 98–156 | |
| Semipapillate | - | 09–10 | - | - | |||
| Sympodial | Papillate | - | - | 98–95 | |||
| Total (n = 128) | 56 | 16 | 38 | 18 | |||
Fig. 1.
Variability in colony morphology of Phytophthora isolates from black pepper. a 05–06. b 11–27. c 98–93. d 09–01. e 11–29. f 98–02
Fig. 2.
Sporangial ontogeny and sex organ formation in representative isolates of Phytophthora infecting black pepper in India. 05–06 (“capsici-like” group); 98–93 (“tropicalis-like” group)
Differential host reaction
To discern the identity, diversity analysis of 18 selected Phytophthora isolates infecting black pepper was undertaken based on symptomatology in black pepper and pothos leaves and compared with that of type cultures of P. capsici (ATCC 4034) and P. tropicalis (ATCC 76,651). The variations in the symptoms induced by the two groups of Phytophthora isolates and type cultures are depicted in Table 3. The “capsici-like” isolates produced comparatively large blackish lesions with fimbriate margin in black pepper and discrete, spot/restricted lesions in pothos (Fig. 3a and b), whereas the “tropicalis-like” isolates induced spot/restricted lesions with yellow halo in black pepper and irregular lesions in pothos (Fig. 3c and d). Few isolates like 01–04, 11–27, 11–29 and 99–162 deviated from the rest of the isolates in symptom expression. No correlation could be established with respect to species, geographical locations, symptoms, elevation or cropping systems. Host inoculation studies in comparison with the type cultures of P. capsici (ATCC 4034) and P. tropicalis (ATCC 76,651) indicated that, in contrast with 05–06, ATCC 4034 produced hypersensitive reaction in black pepper and found to be avirulent to pothos (Fig. 3e and f), while ATCC 76,651 induced expanding lesions in pothos and produced restricted lesions with yellow halo in black pepper (Fig. 3g and h) as observed with 98–93.
Table 3.
Symptomatology of “capsici-like” and “tropicalis-like” Phytophthora isolates on black pepper and pothos in comparison with ATCC type cultures
| Group | Isolate no | On black pepper | On pothos | ||
|---|---|---|---|---|---|
| Leaf symptoms | Average lesion diameter (mm) | Leaf symptoms | Average lesion diameter (mm) | ||
| “Capsici”-like group | 01–03 | Blight-like irregular blackish lesion with mild or prominent fimbriae, with or without yellow halo, mild to severe leaf distortion and defoliation | 23.20 | Spot, circular to irregular blackish lesions with non-prominent yellow halo | 4.20 |
| 01–04 | 13.50 | 6.80 | |||
| 05–06 | 24.50 | 3.30 | |||
| 05–15 | 23.00 | 8.70 | |||
| 06–09 | 38.00 | 8.60 | |||
| 99–162 | 53.00 | 14.00 | |||
| Mean | 59.00 | 7.60 | |||
| P. capsici | ATCC 4034 | Circular blackish lesion, centre not greyish, slightly fimbriate margin and no yellow halo, no leaf distortion | 2.50 | Spot, circular blackish lesion with non-prominent yellow halo | 1.50 |
| “Tropicalis”-like group | 08–07 | Circular to irregular blackish lesion with no or slightly greyish centre, slightly fimbriate margin and prominent yellow halo, no or mild leaf distortion | 8.20 | Blight, irregular blackish lesion with or without prominent yellow halo | 7.50 |
| 11–27 | 23.50 | 3.40 | |||
| 11–29 | 3.00 | 7.50 | |||
| 13–33 | 8.10 | 9.80 | |||
| 97–19 | 10.60 | 3.50 | |||
| 97–53 | 9.00 | 3.60 | |||
| 97–55 | 6.20 | 16.00 | |||
| 98–02 | 18.20 | 9.20 | |||
| 98–07 | 15.20 | 4.00 | |||
| 98–93 | 12.80 | 4.80 | |||
| 98–177 | 13.60 | 8.40 | |||
| Mean | 10.75 | 7.06 | |||
| P. tropicalis | ATCC 76651 | Circular to irregular blackish with greyish centre, slightly fimbriate margin and prominent yellow halo, no leaf distortion | 12.60 | Spot, circular blackish lesion with prominent yellow halo | 4.20 |
Fig. 3.
Symptoms on black pepper (left column) and pothos (right column) leaves on inoculation with different Phytophthora isolates. a and b 05–06 (“capsici-like”). c and d 98–93 (“tropicalis-like”). e and f ATCC 4034 (P. capsici). g and h ATCC 76651 (P. tropicalis)
Molecular characterization
ITS-rDNA sequencing
The ITS-rDNA sequences obtained from 155 Phytophthora isolates, comprising of ITS-1, ITS-2 and 5.8S regions, were submitted to GenBank and the details of accession numbers are given in Supplementary Table 5. On similarity search using BLAST in the IDphy database, 63 isolates out of 155 isolates were grouped as P. capsici (40.65%) and 69 isolates (44.52%) as P. tropicalis. Interestingly, 13 isolates showed similarity to P. mengei, three to P. meadii and one each to P. nicotianae and P. mexicana (Table 4). Five of them did not have a significant sequence similarity with any single Phytophthora species. None of these was submitted to GenBank for want of supporting evidence.
Table 4.
Grouping of Phytophthora isolates infecting black pepper based on ITS sequencing on similarity search with IDphy database [27]
| Identity based on ITS sequencing | Isolate no |
|---|---|
| P. capsici | 00–42, 01–03*, 01–04, 03–02, 03–08, 03–10, 05–05*, 05–06*, 05–09, 05–13, 05–14, 05–15, 05–19, 06–01, 06–02, 06–03, 06–04*, 06–09, 06–10, 06–12, 06–13, 07–02, 07–03, 07–05, 07–06, 08–01, 08–02, 08–03, 08–05, 09–01*, 09–02, 09–15, 09–29, 10–01, 10–02*, 10–03, 10–04, 11–11, 11–17, 13–17, 13–21, 13–30, 13–41, 13–42, 96–18, 97–52, 98–49, 98–50, 98–74, 98–81, 98–87, 98–142, 98–155, 98–164, 98–174, 98–176, 98–183, 98–185, 98–198, 99–162 (60 isolates) |
| P. tropicalis | 00–38, 01–20, 06–08, 08–07, 09–11, 09–19, 09–24, 09–34, 09–39, 11–19, 11–20, 13–07, 13–09, 13–10, 13–11, 13–15, 13–23, 13–24, 13–33, 13–34, 13–36, 13–37, 13–44, 13–47, 13–49, 13–51, 13–52, 13–53, 91–171, 96–02, 96–08, 96–09, 96–10, 97–11, 97–19, 97–53, 97–54, 97–55, 98–02*, 98–03*, 98–07*, 98–17, 98–59, 98–60, 98–66, 98–70, 98–71, 98–75, 98–76, 98–92, 98–128, 98–135, 98–143, 98–145, 98–156, 98–157, 98–163, 98–171, 98–172, 98–182, 99–91, 99–124, 99–136, 99–139, 99–144, 99–145 (66 isolates) |
| P. mengei | 09–13, 09–18, 09–25, 09–26, 09–28, 09–36, 11–27*, 11–28, 11–29*, 11–30, 11–31, 11–32, 98–177 (13 isolates) |
| P. mexicana | 99–132 (1 isolate) |
| P. meadii | 09–03, 09–10, 99–188 (3 isolates) |
| No identity | 08–04, 13–48, 98–01, 98–93*, 98–95 (5 isolates) |
| Total | 148 isolates |
*Isolates used for MLST analysis
ITS-RFLP profiling
The in silico ITS-RFLP analysis using the restriction enzyme Msp I delineated the 108 Phytophthora isolates predominantly into two distinct groups. Isolates of the first group, corresponding to P. capsici and P. mexicana in ITS sequencing, had four fragments of ~ 311, 232, 215 and 154 bp sizes, while isolates of the second group (comprising of P. tropicalis, P. mengei and P. meadii) produced three fragments of ~ 369, 313 and 233 bp (corresponding to P. tropicalis grouping in ITS). The only exceptions are 10–01 and 10–02 of the P. capsici group which produced five bands. Among the isolates studied, 52 isolates (48.6%) belonged to “capsici-like” group and 53 isolates (49.5%) belonged to “tropicalis-like” group (Table 5). The intraspecies variability within these groups was further manifested when the isolates were subjected to in silico RFLP analysis using additional enzymes, Aci I and Alu I. The in silico analysis demarcated each group into subgroups underlining the wide variability existing in the black pepper Phytophthora isolates. Wet lab validation using 15 representative isolates further confirmed the in silico results (Fig. 4).
Table 5.
In silico ITS-RFLP profiling with restriction enzymes Msp I, Aci I and Alu I in different Phytophthora isolates infesting black pepper
| Species/restriction pattern | Msp I | Aci I | Alu I | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 3 bands | 4 bands | 5 bands | 4 bands | 5 bands | 6 bands | 7 bands | 8 bands | 2 bands | 3 bands | 4 bands | |
|
P. capsici (n = 53) |
- | 01–03, 01–04, 03–02, 03–08, 05–05, 05–06, 05–09, 05–13, 05–14, 05–15, 05–19, 06–01, 06–02, 06–03, 06–09, 06–10, 06–12, 06–13, 07–02, 07–03, 07–05, 07–06, 08–01, 08–02, 08–03, 08–05, 09–01, 09–02, 09–29, 10–03, 10–04, 11–11, 11–13, 11–16, 11–17, 96–18, 97–52, 98–48, 98–49, 98–50, 98–74, 98–81, 98–87, 98–142, 98–155, 98–164, 98–174, 98–176, 98–183, 98–185, 98–198 (51 isolates) | 10–01, 10–02 (2 isolates) | 03–02, 05–05, 05–06, 05–09, 06–03, 06–10, 06–12, 06–13, 07–02, 07–05, 07–06, 08–02, 08–03, 10–01, 10–02, 10–03, 10–04, 11–13, 11–16, 11–17 (20 isolates) | 05–19, 06–02, 08–01, 09–01, 09–02, 11–11, 97–52, 98–142 (8 isolates) | 01–03, 01–04, 03–08, 05–13, 05–14, 05–15, 06–01, 06–09, 07–03, 08–05, 09–29, 96–18, 98–48, 98–49, 98–50, 98–74, 98–81, 98–87, 98–155, 98–164, 98–174, 98–176, 98–183, 98–185, 98–198 (25 isolates) | - | - | - | 01–03, 01–04, 03–02, 03–08, 05–05, 05–06, 05–09, 05–13, 05–14, 05–15, 05–19, 06–01, 06–02, 06–03, 06–09, 06–10, 06–12, 06–13, 07–02, 07–03, 07–05, 07–06, 08–01, 08–02, 08–03, 08–05, 09–02, 09–29, 10–01, 10–02, 10–03, 10–04, 11–11, 11–13, 11–16, 11–17, 96–18, 97–52, 98–48, 98–49, 98–50, 98–74, 98–81, 98–87, 98–142, 98–155, 98–164, 98–174, 98–176, 98–183, 98–185, 98–198 (52 isolates) |
09–01 (1 isolate) |
|
P. tropicalis (n = 37) |
00–38, 01–20, 06–08, 09–11, 09–19, 09–39, 91–171, 96–08, 96–09, 96–10, 97–11, 97–53, 97–54, 97–55, 98–02, 98–07, 98–17, 98–59, 98–60, 98–66, 98–70, 98–75, 98–128, 98–135, 98–143, 98–156, 98–157, 98–163, 98–171, 98–172, 98–182, 99–91, 99–124, 99–136, 99–139, 99–144, 99–145 (37 isolates) | - | - | - | 97–55, 98–70 (2 isolates) | 06–08, 98–75, 98–172, 98–182, 99–136, 99–139 (6 isolates) | 09–11, 09–39, 96–08, 96–09, 98–59, 98–128, 98–157, 99–124 (8 isolates) | 00–38, 01–20, 09–19, 91–171, 96–10, 97–11, 97–53, 97–54, 98–02, 98–07, 98–17, 98–60, 98–66, 98–135, 98–143, 98–156, 98–163, 98–171, 99–91, 99–144, 99–145 (21 isolates) | 00–38, 01–20, 06–08, 09–39, 09–11, 09–19, 91–171, 96–10, 97–11, 98–02, 98–60, 98–66, 98–75, 98–143, 98–156, 98–163, 99–91, 99–144, 99–145 (19 isolates) | 96–08, 96–09, 97–53, 97–54, 97–55, 98–07, 98–17, 98–59, 98–70, 98–128, 98–135, 98–157, 98–171, 98–172, 98–182, 99–124, 99–136, 99–139 (18 isolates) | - |
|
P. mengei (n = 13) |
09–13, 09–18,09–25, 09–26, 09–28, 09–36,11–27, 11–28, 11–29, 11–30, 11–31, 11–32, 98–177 (13 isolates) | - | - | - | - | 11–27, 11–28, 11–29, 11–30, 11–31, 11–32 (6 isolates) | 98–177, 09–13(2 isolates) | 09–18, 09–25, 09–26, 09–28, 09–36 (5 isolates) | - | 98–177, 09–13, 09–18, 09–25, 09–26, 09–28, 09–36, 11–27, 11–28, 11–29, 11–30, 11–31 (12 isolates) | 11–32 (1 isolate) |
|
P. mexicana (n = 1) |
- | 99–132 | - | - | 99–132 | - | - | - | - | 99–132 | - |
|
P. meadii (n = 3) |
09–03, 09–10, 99–188 (3 isolates) | - | - | - | - | - | - | 09–03, 09–10, 99–188 (3 isolates) | - | 09–03, 09–10, 99–188 (3 isolates) | - |
SSCP analysis
In the SSCP analysis, Phytophthora isolates from black pepper showed three different banding groups. Majority of the isolates (25 Nos.) produced three bands while six of the isolates (09–26, 11–27, 11–29, 09–01, 09–29 and 10–02) exhibited two bands (Fig. 5), though the pattern showed by 10–02 was quite distinct from the rest. However, it is interesting to note that out of the above six isolates, 09–26, 11–27 and 11–29 belonged to P. mengei while isolates 09–01, 09–29 and 10–02 were P. capsici in ITS sequence analysis. The P. capsici reference isolate from coconut (lane 32 in Fig. 4) exhibited an entirely different banding pattern with four bands when compared to the rest of the isolates. However, the reference isolates from nutmeg, viz. 98–68 and 13–55, were found to be similar to the majority of the isolates with three bands.
Fig. 5.
SSCP analysis of Phytophthora isolates from black pepper. Lanes 1–13 “tropicalis-like” group (1. 91–171; 2. 96–09; 3. 97–11; 4. 97–55; 5. 98–02; 6. 98–03; 7. 98–07; 8. 98–75; 9. 98–93; 10. 99–124; 11. 99–144; 12. 06–17; 13. 09–19); lanes 14–16 P. mengei group (14. 09–26; 15. 11–27; 16. 11–29); 17–31: “capsici-like” group (17. 96–18; 18. 97–52; 19. 98–176; 20. 99–132; 21. 00–42; 22. 01–03; 23. 03–08; 24. 05–05; 25. 05–06; 26. 06–04; 27. 07–03; 28. 08–03; 29. 09–01; 30. 09–29; 31. 10–02) 32. P. capsici from coconut; 33–34; P. tropicalis from nutmeg (33. 98–68; 34. 13–55) M. Marker
MLST and phylogenetic analysis
As reported the primer pairs yielded expected amplicons and all these sequences were submitted in public databases after checking their quality using appropriate tools. The accession numbers obtained for the seven nuclear genes and one mitochondrial gene, cox1, are given in Supplementary Tables 3 and 4, respectively. The consensus tree created in tree finder shows that the Phytophthora isolates, viz. 06–04, 05–05, 01–03, 09–01, 10–02 and 05–06, were closely related to P. capsici and the isolates, viz. 11–27, 11–29, 98–02, 98–07, 98–93 and 98–03, were closely related to P. tropicalis. In all the three trees and in the consensus tree, the black pepper isolates formed two distinct subclades, viz. “capsici-like” and “tropicalis-like” groups wherein the “capsici-like” group was found more closely related to P. glovera and P. mexicana and the “tropicalis-like” group to P. siskiyouensis and P. mengei. The outgroups, viz. Pythium vexans and Halophytophthora fluviatilis, formed entirely a different group. Interestingly, the Phytophthora isolates of our study from black pepper formed distinct group within P. capsici group and it is same in the case of P. tropicalis also (Fig. 6), indicating the evolutionary changes due to host adaption and may be due to suspected inter-species hybridisation. The Cox1 gene-based phylogeny analysis lacked the resolving power indicating the uniparental inheritance of “capsici-like” and “tropicalis-like” groups. However, here also, the “capsici-like” group isolates were found to cluster with P. capsici isolates from NCBI. Two subclusters were noticed within the “capsici-like” group and the isolates from black pepper aligned in the second subcluster along with P. capsici (KF317094) and ATCC4034. In the “tropicalis-like” group, also there were two subclusters but the black pepper isolates got distributed in both the subclusters. The only exception was isolate 08–07 uniquely positioned ancestral to both the groups.
Fig. 6.

Phylogeny for the clade 2 Phytophthora based on concatenated sequences of seven nuclear genetic markers, viz. 60S ribosomal protein L10 (60S), beta-tubulin (ß-tub), elongation factor 1 alpha (EF1α), enolase (Enl), heat shock protein 90 (HSP90), 28S ribosomal DNA (28S) and TigA gene fusion protein (TigA). Topology and branch lengths of maximum likelihood analysis are shown. Bootstrap values for maximum likelihood and neighbour-joining and Bayesian posterior probabilities (percentages) are indicated on individual nodes and separated by a forward slash. A red asterisk is used in place of nodes with unambiguous (> 95%) support in all three analyses. A dash is used in place of a topology from an analysis ambiguous to the other two analyses and these sets of numbers with ambiguity in one analysis are also highlighted in red. Species represented by ex-types and authentic isolates are written in brown and blue, respectively. Scale bar indicates number of substitutions per site
Discussion
Ever since 1996, ICAR-Indian Institute of Spices Research, Kozhikode, Kerala, India has been maintaining a large assemblage of Phytophthora isolates from different spice-growing regions of the country in its National Repository of Phytophthora. The genetic diversity of P. capsici was assessed in various countries using different techniques like random amplified polymorphic DNA (RAPD) [34], amplified fragment length polymorphism (AFLP) [35, 36], single-nucleotide polymorphism (SNPs) [35–38], microsatellite genotyping using SSR markers [14, 39] and next-generation sequencing (NGS) techniques [40]. All these clearly underline the high degree of genetic diversity existing among P. capsici isolates.
Morphological characterization
Phenotypic characterization of more than 100 isolates of Phytophthora showed similarity predominantly to two species of Phytophthora—P. capsici and P. tropicalis. In both the species, isolates formed sporangia in water on direct exposure to light. Sporangia were long, pedicellate with sympodial or umbellate sporangial ontogeny and in many cases both types of ontogeny were observed. According to Waterhouse [41], the umbellate ontogeny is a key characteristic for species such as P. tropicalis, P. brassicae, P. hybernalis and P. morinde. On the other hand, the long pedicellate nature is characteristic to species like P. capsici, P. tropicalis, P. hybernalis, P. siskiyouensis and P. morindae. However, except P. capsici and P. tropicalis, all the above mentioned species were homothallic thereby ruling out the occurrence of such species, viz. P. mengei, P. brassicae, P. hybernalis, P. siskiyouensis (all three belonging to clade III) and P. morinde (clade I) [41].
Presence of chlamydospores is another character to delineate the species. Of the 128 Phytophthora isolates studied, only 39.8% produced chlamydospores while the rest of the isolates were non-chlamydospore producers. Similarly, in an early study involving 50 black pepper isolates (collected from 1996 to 2000), around 50% isolates produced chlamydospores and the isolates showed wide variability in other morphological features [42]. In the present study, except the two asexual phase characters like formation of chlamydospores and pedicel length, all other features like colony morphology, sporangiophore morphology and sporangia papillation were not consistent in the above two groups, giving room for misidentification. Overlapping of morphological characters in closely related P. capsici and P. tropicalis has been well documented in earlier status papers published almost one decade ago [43, 44]. However, a more clear picture emerged with the availability of IDphy tool [27] (https://idtools.org/id/phytophthora/). They classified isolates producing chlamydospores and with umbellate or simple sympodial sporangiophores, long pedicel, papillate sporangia as P. tropicalis. Phytophthora capsici is described as without formation of chlamydospores, with small/medium/long pedicel as well as papillate/semipapillate sporangia. In our study though the isolates could be grouped into two major groups based on formation of chlamydospores, the rest of the characters differed. The pedicel length in all of the isolates belonging to “capsici-like” group was long. The isolates in “tropicalis-like” group had either medium or long pedicels.
There is a prevalence of two subpopulations (CapA and CapB) in 113 isolates of P. capsici infesting a range of crops through morphological, physiological and isozyme analysis [45]. This included P. capsici from India including black pepper isolates. The key difference between CapA and CapB subpopulations identified in the above study was the presence and absence of chlamydospores as observed in our study. CapB subpopulation capable of producing chlamydospores should be P. tropicalis as described by Aragaki and Uchida [46] and recently by Abad et al. [27], so morphological traits are not reliable for identifying black pepper Phytophthora isolates.
Differential host reaction
The isolates could be primarily differentiated based on the formation of unrestricted lesions with fimbriate margin and spot/restricted lesions with yellow halo. The analysis established that the “capsici-like” isolates in black pepper are distinct from the type culture of P. capsici infecting chilli. Since the symptoms produced by type culture of P. tropicalis in black pepper are comparable with the symptoms induced by the putative P. tropicalis group, this indicates that Phytophthora infecting black pepper comprises two species—P. tropicalis and P. capsici-like species and not P. capsici alone, as reported earlier.
Molecular characterization
ITS sequencing has predominantly grouped black pepper isolates as either P. capsici or P. tropicalis and a few as the closely related basal species, P. mengei and P. mexicana. Phytophthora mengei is a homothallic species reported on avocado producing plerotic oospores with paragynous antheridia and non-caducous semipapillate sporangia [47]. Unlike P. capsici and P. tropicalis, P. mexicana and P. mengei are non-caducous and hence their presence in black pepper tracts in South India is ruled out. Besides, there were a few sequences which did not match with any single species, again indicating the poor resolving power of ITS-based identification. In an earlier study from the same institute, it was observed that black pepper isolates grouped in a separate cluster, sharing characteristics of both P. capsici and P. tropicalis based on ITS sequence similarity and predicted secondary structure [24]. In Sarawak, Malaysia, Phytophthora isolates from black pepper were proved as P. capsici using ITS amplification [48]. But the isolates exhibited globose sporangia, paragynous antheridia and chlamydospores with torulose hyphae and lemon-shaped sporangia on long pedicels, similar to P. tropicalis.
Subsequent ITS-RFLP analysis also grouped majority of the isolates into two major groups—“capsici-like” and “tropicalis-like” groups. However, there is lot of intrinsic variability within these groups as indicated by different banding patterns among the isolates. Yang and Hong [49] have suggested ITS as one of the most informative genetic markers for identifying Phytophthora species. However, our study shows high variability in the ITS region of Indian isolates infecting black pepper. SSCP, a tool for detecting point mutations, failed to differentiate the “capsici-like” and “tropicalis-like” groups. Instead, three each “mengei-like” isolates (09–26, 11–27 and 11–29) and “capsici-like” (09–01, 09–29 and 10–02) isolates showed a unique pattern with four bands, again underlining the significant overlapping in these Phytophthora isolates. Like ITS-RFLP, ITS-SSCP also strongly indicate the mixing up in the genetic pool of Phytophthora isolates putatively demarcated as “capsici-like” and “tropicalis-like” groups. Cooke et al. [25] have unambiguously stated that ITS sequences alone will not always distinguish between species and that phenotypically unique taxa may sometimes have similar or even identical ITS profiles in the context of hybridization. ITS region contains a large number of variable sites, and as evolutionary distance increases, the quality of the multiple sequence alignment of ITS data quickly degrades and ITS phylogeny may not be a good estimate of organism phylogeny [17, 50].
Multilocus sequence typing
MLST involving seven nuclear genes also clearly proved the presence of two distinct groups with mixed characters indicating species diversification in black pepper agro-ecosystems. Phylogenetic analysis using different methods, viz., maximum likelihood (ML), neighbour-joining (NJ) and Bayesian analyses (BA), all produced the same topology and resolution. The placement of P. glovera between P. capsici and P. tropicalis was also observed by earlier workers [18, 51]. Similarly, P. siskiyouensis, P. mengei and P. brasiliensis also grouped together in subclade 2b as reported earlier [18, 47]. Phytophthora brasiliensis from Theobroma cacao was earlier described as P. capsici but Bowers et al. [3] elevated it as a novel species based on MLST analysis and phylogeny. In the present study, cox1 phylogeny, though grouped P. capsici and P. tropicalis isolates separately, the branches have only moderate to low or inconsistent support, indicating that cox1 is not useful for assigning species to (sub)clades nor for identifying hybrid taxa [49]. This is in contradiction with the observation of Robideau et al. [52] and Rahman et al. [53] that the cox1 gene was more discriminative than the ITS regions at the species level. Yang and Hong [49] highlighted the importance of using additional markers to identify Phytophthora isolates in all clades, perhaps with the exception of clade 10, as identical and other almost identical ITS sequences (distance ≤ 0.001 or difference between sequences ≤ 10 bases) were found in clades 1–9. Yang et al. [19] suggested using concatenations of much larger numbers of genes to increase the phylogenetic resolution among Phytophthora species as done by Ye et al. [54].
In view of the data generated for morphology and molecular analysis in the present study, it is confirmed that both P. capsici and P. tropicalis are the causal organisms for Phytophthora foot rot of black pepper in India. The extensive studies carried out have convincingly proved the presence of chlamydospore-producing and non-chlamydospore-producing isolates in the black pepper ecological niches. It may be recollected that the causal organism of foot rot disease of black pepper was originally identified as P. palmivora MF4 because of its morphological dissimilarities with the typical P. palmivora [55]. Subsequently, based on its morphology and biochemical profile, P. palmivora MF4 was placed into a revised version of P. capsici [12]. However, later some workers have designated those attacking Piper as P. capsici f. sp. piperis [5] or as P. tropicalis [46]. As indicated by several previous workers [45], it is now confirmed that the Phytophthora pool in black pepper is a concoction of P. capsici and P. tropicalis. In another recent study, we have developed a Ypt1 gene-based recombinase polymerase amplification assay for differentiating P. capsici and P. tropicalis in black pepper [56]. Combined presence of P. tropicalis and P. capsici has been reported from Vietnam also causing foot rot (quick wilt) disease of black pepper [57]. Interestingly, they formed distinct groups within clade 2b, indicating further evolutionary changes due to host adaption, crossing and suspected inter-species hybridisation. Presence of multiple distinct sub groups of individuals within P. capsici/P. tropicalis, because of local selection pressures, was strongly indicated by Storey [58] on applying NGS technologies. Natural selection contributes to ecological adaptation and as a consequence, drives phenotypic diversification, population divergence, evolution of reproductive isolation and formation of new species.
Conclusion
Foot rot disease of black pepper is a serious disease prevalent in all pepper-growing countries. The causal organism is proved to be Phytophthora capsici in several studies conducted during the past several decades. However, with the emergence of molecular techniques, we noticed extensive variability in the Phytophthora populations associated with the crop in India. In order to resolve this ambiguity, we have selected 182 isolates of Phytophthora, collected from different black pepper-growing tracts of South India during 1998–2013 and subjected to morphological, molecular and phylogenetic characterization. ITS-based analyses indicated two clear cut groups—“capsici-like” and “tropicalis-like”, among them. Furthermore, representative isolates from each group were subjected to host differential test, multilocus sequence typing (MLST) and phylogeny studies which clearly delineated black pepper Phytophthora isolates into P. capsici and P. tropicalis. So based on the extensive analysis, it is unambiguously proved that the foot rot disease of black pepper in India is predominantly caused by two species of Phytophthora, viz. P. capsici and P. tropicalis. This is the first comprehensive study delineating the two closely related P. capsici and P. tropicalis infecting black pepper in India. The results of the study clearly warrant to revisit to the existing recommendations to control this disease in black pepper gardens. As large populations of sexually reproducing individuals are involved in the black pepper rhizosphere, there will be very high sequence polymorphisms shared among these sibling species which is destined to confound the inference of a reliable phylogeny. There is an urgent need to sequence the whole genomes of multiple isolates from the species of interest. Improved phylogenetic methods have to be employed to resolve and to understand the silent molecular evolution taking place in a unique ecological niche with multitude of plant-pathogen combinations characteristic to the tropical and sub-tropical environments.
The authors declare that the submitted work is original and has neither been published elsewhere nor submitted for publication. All authors also declared that the data or images have not been manipulated.
Supplementary Information
Below is the link to the electronic supplementary material.
Author contribution
Conceptualization: M. Anandaraj, Santhosh J. Eapen; methodology: R. Suseela Bhai, Santhosh J. Eapen; formal analysis and investigation: A. Jeevalatha, C. N. Biju, K. B. Vinitha, Cissin Jose, O. B. Rosana, A. Fayad; writing—original draft preparation: R. Suseela Bhai; writing—review and editing: A. Jeevalatha, Santhosh J. Eapen; funding acquisition: M. Anandaraj; resources: R. Praveena, Santhosh J. Eapen; supervision: M. Anandaraj, Santhosh J. Eapen.
Funding
The authors received funding from ICAR, New Delhi through an outreach project—PHYTOFURA (F. No.16–2/08/outreach-PP).
Data availability
All nucleotide sequence data were submitted to GenBank public nucleic acid sequence repository (https://www.ncbi.nlm.nih.gov/genbank/) and their accession numbers are listed as Supplementary Tables 3–5. The multiple sequence alignment of datasets are submitted to the TreeBASE.
Code availability
Not applicable.
Declarations
Ethics approval
This article does not contain any experiments with human participants or animals.
Consent to participate
All authors agreed with the content and that all gave explicit consent to submit and obtained consent from the institute/organization where the work has been carried out.
Consent for publication
All authors have read very carefully and approved the current version of this manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Pratibha VH, Hegde V, Sharadraj KM, Rajesh MK, Rachana KE, Chowdappa P. Differentiation of Phytophthora species associated with plantation crops using PCR and high-resolution melting curve analysis. J Plant Pathol. 2018;100:233–240. doi: 10.1007/s42161-018-0065-3. [DOI] [Google Scholar]
- 2.Donahoo RS, Lamour KH. Interspecific hybridization and apomixis between Phytophthora capsici and Phytophthora tropicalis. Mycologia. 2008;100(6):911–920. doi: 10.3852/08-028. [DOI] [PubMed] [Google Scholar]
- 3.Bowers JH, Martin FN, Tooley PW, Luz EDMN. Genetic and morphological diversity of temperate and tropical isolates of Phytophthora capsici. Phytopathology. 2007;97:492–503. doi: 10.1094/PHYTO-97-4-0492. [DOI] [PubMed] [Google Scholar]
- 4.Leonian LH. Stem and fruit blight of peppers caused by Phytophthora capsici sp. nov. Phytopathology. 1922;12(9):401–408. [Google Scholar]
- 5.Holliday P. A dictionary of plant pathology. Cambridge: Cambridge University Press; 2001. [Google Scholar]
- 6.Gevens AJ, Donahoo RS, Lamour KH, Hausbeck MK. Characterization of Phytophthora capsici from Michigan surface irrigation water. Phytopathology. 2007;97:421–428. doi: 10.1094/PHYTO-97-4-0421. [DOI] [PubMed] [Google Scholar]
- 7.Lamour KH, Hausbeck MK. Mefenoxam insensitivity and the sexual stage of Phytophthora capsici in Michigan cucurbit fields. Phytopathology. 2000;90:396–400. doi: 10.1094/PHYTO.2000.90.4.396. [DOI] [PubMed] [Google Scholar]
- 8.Ristaino JB, Johnston SA. Ecologically based approaches to management of Phytophthora blight on bell pepper. Plant Dis. 1999;83:1080–1089. doi: 10.1094/PDIS.1999.83.12.1080. [DOI] [PubMed] [Google Scholar]
- 9.Alizadeh A, Tsao PH. Effect of light on sporangium formation, morphology, ontogeny, and caducity of Phytophthora capsici and “P. palmivora” MF4 isolates from black pepper and other hosts. Trans Br Mycol Soc. 1985;85:47–69. doi: 10.1016/S0007-1536(85)80155-8. [DOI] [Google Scholar]
- 10.Oudemans P, Coffey MD. A revised systematics of twelve papillate Phytophthora species based on isozyme analysis. Mycol Res. 1991;95:1025–1046. doi: 10.1016/S0953-7562(09)80543-1. [DOI] [Google Scholar]
- 11.Uchida JY, Aragaki M. Occurrence of chlamydospores in Phytophthora capsici. Mycologia. 1985;77:832–835. doi: 10.1080/00275514.1985.12025170. [DOI] [Google Scholar]
- 12.Tsao PH, Alizadeh A (1988) Recent advances in the taxonomy and nomenclature of the so-called “Phytophthora palmivora” MF-4 occurring on cocoa and other tropical crops. In: Proceedings of 10th International Cocoa Research Conference, Santo Domingo, Dominican Republic, pp. 441–445
- 13.Mchau GRA, Coffey MD. An integrated study of morphological and isozyme patterns found within a worldwide collection of Phytophthora citrophthora and a redescription of the species. Mycol Res. 1994;98:1291–1299. doi: 10.1016/S0953-7562(09)80301-8. [DOI] [Google Scholar]
- 14.Cissin J, Bhai RS, Vinitha KB, Babu KN, Anandaraj M (2016) Cross species amplification of microsatellite loci from Phytophthora spp. to assess genetic diversity among the Phytophthora isolates from black pepper. J Spices Aromatic Crops 25(2):104–112. https://updatepublishing.com/journal/index.php/josac/article/view/5172
- 15.Vinitha KB, Ananadaraj M, Bhai RS. Virulence of Phytophthora isolates from Piper nigrum L. and their sensitivity to metalaxyl-mancozeb. J Plant Crops. 2016;44(2):67–76. doi: 10.19071/jpc.2016.v44.i2.3100. [DOI] [Google Scholar]
- 16.Chen QH, Weng QY, Wang YC, Zheng XB. Identification and sequencing of ribosomal DNA-ITS of Phytophthora sojae in Fujian. Acta Phytopathologica. 2004;34(2):112–116. [Google Scholar]
- 17.Blair JE, Coffey MD, Park SY, Geiser DM, Kang S. A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. Fungal Genet Biol. 2008;45(3):266–277. doi: 10.1016/j.fgb.2007.10.010. [DOI] [PubMed] [Google Scholar]
- 18.Martin FN, Blair JE, Coffey MD. A combined mitochondrial and nuclear multilocus phylogeny of the genus Phytophthora. Fungal Genet Biol. 2014;66:19–32. doi: 10.1016/j.fgb.2014.02.006. [DOI] [PubMed] [Google Scholar]
- 19.Yang X, Tyler BM, Hong C. An expanded phylogeny for the genus Phytophthora. IMA Fungus. 2017;8(2):355–384. doi: 10.5598/imafungus.2017.08.02.09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Tsao PH, Guy S. Inhibition of Mortierella and Pythium in a Phytophthora isolation medium containing Hymexazol. Phytopathol. 1977;67:798–801. [Google Scholar]
- 21.Bhai RS, Anandaraj M, Sarma YR, Veena SS, Saji KV (2007) Screening of black pepper (Piper nigrum L.) germplasm for resistance to foot rot disease caused by Phytophthora capsici Leonian. J Spices Aromatic Crops 16(2):115–117. https://updatepublishing.com/journal/index.php/josac/article/view/4876
- 22.Prakash KM, Bhai RS, Jiji J, Saji KV, Sujatha VS, Santhoshkumar AV. Exploitation of resistant sources to Phytophthora capsici Leon. from genetic stocks of black pepper (Piper nigrum L.) Int J Curr Microbiol Appl Sci. 2019;8(5):1487–1496. doi: 10.20546/ijcmas.2019.805.171. [DOI] [Google Scholar]
- 23.Erwin DC, Ribeiro OK. Phytophthora diseases worldwide. St. Paul, Minnesota: American Phytopathological Society; 1996. [Google Scholar]
- 24.Sheji C, Renu SG, Balaji S, Anandaraj M. Ribosomal DNA analysis of three Phytophthora species occurring in India. Indian Phytopathol. 2009;62(2):155–162. [Google Scholar]
- 25.Cooke DE, Drenth A, Duncan JM, Wagels G, Brasier CM. A molecular phylogeny of Phytophthora and related oomycetes. Fungal Genet Biol. 2000;30:17–32. doi: 10.1006/fgbi.2000.1202. [DOI] [PubMed] [Google Scholar]
- 26.White TJ, Bruns T, Lee S, Taylor J, et al. Analysis of phylogenetic relationships by amplification and direct sequencing of ribosomal RNA genes. In: Innis MA, et al., editors. PCR protocols: a guide to methods and applications. New York: Academic; 1990. pp. 315–322. [Google Scholar]
- 27.Abad ZG, Burgess T, Bienapfl JC, Redford AJ, Coffey M, Knight L (2019) IDphy: molecular and morphological identification of Phytophthora based on the types. USDA APHIS PPQ S&T Beltsville Lab, USDA APHIS PPQ S&T ITP, Centre for Phytophthora Science and Management, and World Phytophthora Collection. https://idtools.org/id/phytophthora/ index.php. Accessed 31August 2021
- 28.Kong P, Hong CX, Tooley PW, Ivors K, Garbelotto M, Richardson PA. Rapid identification of Phytophthora ramorum using PCR-SSCP analysis of ribosomal DNA ITS-1. Lett Appl Microbiol. 2004;38:433–439. doi: 10.1111/j.1472-765X.2004.01510.x. [DOI] [PubMed] [Google Scholar]
- 29.Rubio L, Ayllón MA, Guerri J, Pappu H, Niblett C, Moreno P. Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Ann Appl Biol. 1996;129:479–489. doi: 10.1111/j.1744-7348.1996.tb05770.x. [DOI] [Google Scholar]
- 30.Larkin MA, Blackshields G, Brown NP, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
- 31.Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser. 1999;41:95–98. [Google Scholar]
- 32.Posada D. jModelTest: phylogenetic model averaging. Mol Biol Evol. 2008;25(7):1253–1256. doi: 10.1093/molbev/msn083. [DOI] [PubMed] [Google Scholar]
- 33.Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol. 2012;61(3):539–542. doi: 10.1093/sysbio/sys029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Silvar C, Merino F, Díaz J. Diversity of Phytophthora capsici in Northwest Spain: analysis of virulence, metalaxyl response, and molecular characterization. Plant Dis. 2006;90(9):1135–1142. doi: 10.1094/PD-90-1135. [DOI] [PubMed] [Google Scholar]
- 35.Hulvey J, Hurtado-Gonzalez O, Aragón-Caballero L, Gobena D, Storey D, Finley L, Lamour K. Genetic diversity of the pepper pathogen Phytophthora capsici on farms in the Amazonian high jungle of Peru. American J Plant Sci. 2011;2:461–466. doi: 10.4236/ajps.2011.23054. [DOI] [Google Scholar]
- 36.Gobena D, Roig J, Galmarini C, Hulvey J, Lamour K. Genetic diversity of Phytophthora capsici isolates from pepper and pumpkin in Argentina. Mycologia. 2012;104(1):102–107. doi: 10.3852/11-147. [DOI] [PubMed] [Google Scholar]
- 37.Castro-Rocha A, Shrestha S, Lyon B, et al. An initial assessment of genetic diversity for Phytophthora capsici in northern and central Mexico. Mycol Progress. 2016;15:15. doi: 10.1007/s11557-016-1157-0. [DOI] [Google Scholar]
- 38.Castro-Rocha A, Hulvey JP, Wick R, Shrestha SK, Lamour K. Genetic diversity of Phytophthora capsici recovered from Massachusetts between 1997 and 2014. Mycol Progress. 2017;16:999–1006. doi: 10.1007/s11557-017-1334-9. [DOI] [Google Scholar]
- 39.Chen XR, Zhang Y, Huang SX, Liu TT, Qiao GH. Investigation of the genetic diversity of Phytophthora capsici in China using a universal fluorescent labelling method. J Phytopathol. 2018;167:111–122. doi: 10.1111/jph.12779. [DOI] [Google Scholar]
- 40.Sun WX, Jia YJ, O'Neill NR, Feng BZH, Zhang XG. Genetic diversity in Phytophthora capsici from eastern China. Can J Plant Pathol. 2008;30(3):414–424. doi: 10.1080/07060660809507539. [DOI] [Google Scholar]
- 41.Waterhouse GM (1963) Key to the species of Phytophthora de Barry. Mycological Papers No. 92, Commonwealth Mycological Institute, Kew, UK
- 42.Vijaya P (2008) Studies on characterization and variability of Phytophthora species pathogenic to black pepper (Piper nigrum). Ph. D. Thesis, University of Calicut, Kerala, India
- 43.Kroon LPNM, Brouwer H, de Cock AWAM, Govers F. The genus Phytophthora anno 2012. Phytopathology. 2012;102:348–364. doi: 10.1094/PHYTO-01-11-0025. [DOI] [PubMed] [Google Scholar]
- 44.Martin FN, Abad ZG, Balci Y, Ivors K. Identification and detection of Phytophthora: reviewing our progress, identifying our needs. Plant Dis. 2012;96:1080–1103. doi: 10.1094/PDIS-12-11-1036-FE. [DOI] [PubMed] [Google Scholar]
- 45.Mchau GRA, Coffey MD. Evidence for the existence of two subpopulations in Phytophthora capsici and a redescription of the species. Mycol Res. 1995;99:89–102. doi: 10.1016/S0953-7562(09)80321-3. [DOI] [Google Scholar]
- 46.Aragaki M, Uchida JY. Morphological distinctions between Phytophthora capsici and P. tropicalis sp. nov. Mycologia. 2001;93:137–145. doi: 10.1080/00275514.2001.12061285. [DOI] [Google Scholar]
- 47.Hong CX, Gallegly ME, Browne GT, Bhat RG, Richardson PA, Kong P. The avocado subgroup of Phytophthora citricola constitutes a distinct species, Phytophthora mengei sp nov. Mycologia. 2009;101:833–840. doi: 10.3852/08-214. [DOI] [PubMed] [Google Scholar]
- 48.Farhana MDSN, Rahamah Bivi M, Khairulmazmi A, Wong SK, Sariah M. Morphological and molecular characterization of Phytophthora capsici, the causal agent of foot rot disease of black pepper in Sarawak, Malaysia. Int J Agric Biol. 2013;15:1083–1090. [Google Scholar]
- 49.Yang X, Hong C. Differential usefulness of nine commonly used genetic markers for identifying Phytophthora species. Front Microbiol. 2018;9:2334. doi: 10.3389/fmicb.2018.02334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Nieto Feliner G, Rosselló JA. Better the devil you know? Guidelines for insightful utilization of nrDNA ITS in species-level evolutionary studies in plants. Mol Phylogenet Evol. 2007;44(2):911–919. doi: 10.1016/j.ympev.2007.01.013. [DOI] [PubMed] [Google Scholar]
- 51.Abad ZG, Ivors KL, Gallup CA, Abad JA, Shew HD. Morphological and molecular characterization of Phytophthora glovera sp. nov. from tobacco in Brazil. Mycologia. 2011;103(2):341–350. doi: 10.3852/09-157. [DOI] [PubMed] [Google Scholar]
- 52.Robideau GP, de Cock AWAM, Coffey MD, et al. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol Ecol Resour. 2011;11:1002–1011. doi: 10.1111/j.1755-0998.2011.03041.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Rahman MZ, Uematsu S, Coffey MD, Uzuhashi S, Suga H, Kageyama K. Re-evaluation of Japanese Phytophthora isolates based on molecular phylogenetic analyses. Mycoscience. 2014;55:314–327. doi: 10.1016/j.myc.2013.11.005. [DOI] [Google Scholar]
- 54.Ye W, Wang Y, Shen D, Li D, Pu T, et al. Sequencing of the litchi downy blight pathogen reveals it is a Phytophthora species with downy mildew-like characteristics. Mol Plant-Microbe Int. 2016;29:573–583. doi: 10.1094/MPMI-03-16-0056-R. [DOI] [PubMed] [Google Scholar]
- 55.Stamps DJ, Waterhouse GM, Newhook FJ, Hall GS (1990) Revised tabular key to the species of Phytophthora. Mycological papers No. 162, CAB International, Wallingford Oxon, UK
- 56.Jeevalatha A, Biju CN, Bhai RS. Ypt1 gene-based recombinase polymerase amplification assay for Phytophthora capsici and P. tropicalis detection in black pepper. Eur J Plant Pathol. 2021;159:863–875. doi: 10.1007/s10658-021-02211-0. [DOI] [Google Scholar]
- 57.Dung PN, Cuong HV, Tuat NV, Matsumoto M. Analysis of internal transcribed spacer (ITS) region of Phytophthora tropicalis causing quick wilt disease of black pepper in Vietnam. Arch Phytopathol Plant Prot. 2014;47(7):842–851. doi: 10.1080/03235408.2013.823713. [DOI] [Google Scholar]
- 58.Storey DB (2014) World wide diversity of Phytophthora capsici. PhD dissertation, University of Tennessee, USA. https://trace.tennessee.edu/utk_graddiss/2862
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
All nucleotide sequence data were submitted to GenBank public nucleic acid sequence repository (https://www.ncbi.nlm.nih.gov/genbank/) and their accession numbers are listed as Supplementary Tables 3–5. The multiple sequence alignment of datasets are submitted to the TreeBASE.
Not applicable.




