Characterization of two new strains of Lactococcus lactis for their probiotic efficacy over commercial synbiotics consortia

Abstract

Lactococcus spp. are industrially crucial lactic acid bacteria (LAB) used to manufacture lactic acid, pickled vegetables, buttermilk, cheese, and many kinds of delicious dairy foods and drinks. In addition to these, they are also being used as probiotics in specific formulations. However, their uses as probiotics are comparatively less than the other LAB genera. The present communication hypothesizes to validate the probiotic potentiality of two new Lactococcus lactis subsp. lactis strains for their future uses. These native food fermenting strains were characterized for in vitro acid tolerance, tolerance to simulated gastric and pancreatic juices, autoaggregation and co-aggregation, hydrophobicity, haemolytic activity, bile salt deconjugation, cholesterol removal, antimicrobial spectrum, and antibiotic sensitivity. The in vivo live bacterial feeding of these strains for 30 days was done in Swiss albino mice either singly or in combination with prebiotic inulin and evaluated for hypocholesterolemic activity, immune enhancement, and gut colonization efficiency and compared with the commercial probiotic consortia. The study revealed that the strains could survive in human gut bile concentration, gastric pH conditions at pH 2.0, 3.0, and 8.0 for 6 h, had a broad antibacterial spectrum, and cholesterol binding efficacy. The strains could survive with higher colony-forming units (CFU/mL) when amended with sodium caseinate. The strains had autoaggregation ranges from 15 to 25% over 24 h and had a significant co-aggregation with both lactic acid and Gram-positive and Gram-negative bacterial strains related to human illness. The strains also showed solvent and media-specific hydrophobicity against n-hexane and xylene. The live bacterial feeding either singly or in combination with prebiotic inulin resulted in a significant reduction of LDL (low-density lipoprotein), VLDL (very low-density lipoprotein) cholesterol and triglyceride (TG), and a significant increase in HDL (high-density lipoprotein) cholesterol level, and improved gut colonization and gut immunomodulation. The results prove that these non-haemolytic, non-toxic strains had significant health benefits than the commercial probiotics consortium with the recommended prebiotics mix. Thus, these new Lactococcus lactis subsp. lactis strains could be trialled as a new probiotic combination for human and animal feeds.

Supplementary Information

The online version contains supplementary material available at 10.1007/s42770-022-00685-6.

Introduction

The microbial population of the gastrointestinal tract, mainly in the gut, exerts a symbiotic relationship with the host. The term ‘normobiosis’ characterizes the gut ‘ecosystem’ condition where the potential health-benefiting microorganisms predominate over many potentially harmful microorganisms. On the other hand, ‘dysbiosis’ characterizes where one or a few potentially harmful microorganisms are dominated, creating a diseased situation [1]. These inhabited fruitful microbial communities are often called probiotics to provide metabolic, immunologic, and protective functions that play a crucial role in human and animal health [2–4]. Many factors, including genetics, host physiology, and hosts’ living conditions, also influence gut eco-physiology [5–7]. The application of starter cultures has become state of the art in most industrial food fermentation as it allows process standardization, mitigation of hygienic risks, and product diversification. The genus Lactococcus, a mesophilic lactic acid bacteria (LAB), is the dairy industry’s most widely used starter bacteria to produce various fermented foods like cheeses, sour milk, and cream buttermilk, and other traditional fermented dairy products [8]. They can grow well in milk and fermented vegetables and do not require additional compounds or accelerator bacteria, unlike Lactobacillus acidophilus [9]. Moreover, they can utilize a wide range of substrates, survive in microaerophilic or anaerobic conditions, produce acids (lactate, acetate, propionate, etc.), and decrease the pH and redox potential. They produce bacteriocins and antifungal compounds active against a broad or limited spectrum of target organisms, including the food spoilage and toxigenic microorganisms, and imparts in quality-enhancing and self-preservation properties of fermented food products [10].

Despite their well-established starter culture properties in various fermented foods, their commercial uses as probiotics have been less emphasized (Fig. S1). For the selection of new probiotic microorganisms, the safety of probiotic microorganisms has been of prime importance. Fortunately, Lactococci do not have any problem regarding their safety because, like lactobacilli, they also have Generally-Recognized-as-Safe (GRAS) status, Foods for Specified Health Use (FOSHU) status, and Qualified Perception of Safety (QPS) status [11, 12] except two species; viz. L. garvieae and L. piscium have been recognized as pathogens in fish aquaculture [13]. Members of the genus Lactococcus are classified into five species: Lactococcus lactis, L. garvieae, L. piscium, L. plantarum, and L. raffinolactis [14]. Among them, L. lactis has been genetically subdivided into four subspecies: L. lactis subsp. lactis, L. lactis subsp. hordniae, L. lactis subsp. cremoris, and L. lactis subsp. tructae [14]. The strains of L. lactis subsp. lactis are typically associated with dairy and vegetable fermentation. However, the citrate-utilizing L. lactis subsp. lactis is now recognized as L. lactis subsp. lactis biovar diacetylactis [15]. Certain non-dairy L. lactis strains might also exhibit flavour-forming traits beneficial to dairy fermentation. The principal flavour forming enzymes are transaminase, which catalyses the transfer of the amino acids to the corresponding α-keto acids (α-ketoglutarate) while fermenting dairy products and glutamate dehydrogenase that converts glutamate to α-ketoglutarate while fermenting non-dairy substrates [16–18]. The technological interventions are also being applied to the lactococci to enhance their industrial applications, such as lactose utilization, proteinase activity, citrate metabolism, exo-polysaccharide production, and bacteriocins [19]. Several studies indicated that probiotic supplementation improved the antioxidant status of fermented foods [20–23]. Heshmati et al. [24] evaluated the effect of probiotics (or synbiotics) supplementation in women suffering from polycystic ovary syndrome (PCOS) and showed that the probiotic or synbiotic treatments had improved the quantitative insulin sensitivity check index (QUICKI), decreased TG level, fasting insulin, and increased HDL, indicating their significant impact on health improvement. Pereira et al. [25] studied the proteolysis and angiotensin-converting enzyme (ACE) inhibitory activity of a fermented dairy beverage produced with goat whey powder and a probiotic culture of L. casei BGP93 co-cultured with Streptococcus thermophilus TA-40. The study concludes that the probiotic beverage application has potency as a functional food candidate to be included in a dietary strategy to prevent and control hypertension.

The present study reports on the characterization of the probiotic potentiality of two new Lactococcus lactis subsp. lactis strains isolated from fermented foods of Darjeeling Hills, India, in in vitro and in vivo Swiss albino mice model and to compare their health beneficial attributes over commercial probiotic-prebiotic consortia.

Materials and methods

Isolation of probiotic LAB

Two bile salt hydrolase active LAB strains, LAB-17 and LAB B1.1, isolated from the traditional fermented food ‘Kinema’ [26], were screened for their antibacterial properties (bacteriocin production) against the human pathogenic bacterial strains by spot-on-lawn and agar-well diffusion methods [27, 28], as well as antifungal potentiality against food spoilage and human pathogenic, mycotoxigenic, and phytopathogenic fungi by dual culture streak plate method [29] as listed in Table 1. The strains were also evaluated for in vitro and in vivo probiotic properties, as described later.

Table 1.

Antimicrobial spectrum of the strains

Microorganisms tested	Strain properties	Zone of inhibition (cm ± SD)
		LAB-17	LAB B1.1
A) Bacterial strains
Bacillus cereus MTCC 1272	Food borne pathogen	1.0 ± 0.2	1.1 ± 0.3
Bacillus subtilis MTCC 411	Food borne pathogen	1.1 ± 0.2	1.0 ± 0.1
Enterococcus faecalis MB1*	Sensitive to bacteriocin	1.1 ± 0.3	0.9 ± 0.2
Escherichia coli MTCC 1667	Gastroenteritis pathogen; colicin indicator strain	-	-
Leuconostoc mesenteroides Ly*	Sensitive to bacteriocin	1.3 ± 0.3	1.2 ± 0.2
Listeria monocytogenes MTCC 657	Human pathogen cause listeriosis	1.1 ± 0.1	0.8 ± 0.3
Staphylococcus cohnii subsp. cohnii MCC 2187 (T)	Skin borne multi drug-resistant pathogens	1.0 ± 0.2	1.2 ± 0.1
Streptococcus mutans MTCC 890	Dental caries pathogen of human	1.2 ± 0.2	1.4 ± 0.4
B) Fungal strains
Alternaria solani MTCC 2101	Causes early blight of potato	2.7 ± 0.3	2.2 ± 0.1
Aspergillus flavus MTCC 2799	Aflatoxin producer	3.8 ± 0.2	2.7 ± 0.4
Aspergillus parasiticus MTCC 2796	Aflatoxin producer	3.2 ± 0.2	3.4 ± 0.3
Candida albicans MTCC 183	Human pathogen	1.1 ± 0.2	0.9 ± 0.1
Colletotrichum acutatum MTCC 2074	Cause blight of banana	2.9 ± 0.2	3.2 ± 0.3
Curvularia lunata MTCC 2098	Food spoilage pathogen	0.9 ± 0.2	± 0.2
Fusarium oxysporum f. sp. pisi MTCC 2480	Causes wilt disease of pea	2.7 ± 0.3	2.3 ± 0.15
Helminthosporium compactum MTCC 351	Cause brown spot of rice	2.4 ± 0.15	2.1 ± 0.2

MTCC microbial-type culture collection and gene bank, Chandigarh, India; MCC microbial culture collection; NCCS National Centre for Cell Science, Pune, India. Here, the numbers indicate the zone of growth inhibition

* are the standard bacteriocin sensitive strains

Morphobiochemical and molecular characterization of the LAB strains

The morphology of the strains was observed under a scanning electron microscope (SEM, Zeiss Evo 18, Germany) following the methodology of Mandal et al. [30]. The strains’ biochemical characterization and carbohydrate utilization profile was done using HiCarbohydrate™ Kit (KB009, HiMedia, Mumbai, India) (Table 2) following the manufacturer’s guideline. The gas production by the strains was detected by the Durham tube method using glucose as fermenting substrate. The molecular identification and phylogeny were made using 16S rRNA gene sequence homologies and phylogenetic relationship analyses. The PCR of the 16S rRNA gene was done by using 16S rRNA specific universal eubacterial primers (8F and 1491R) (Table 3) [31–34] using Veriti® 96 well Thermal Cycler (Model No. 9902, USA), following the methodology of Suzuki and Giovannoni [35]. All the PCR programs were run with an initial denaturation at 95 °C for 5 min, followed by 35 cycle denaturation (at 95 °C for 30 s), extension (at 72 °C for 1.30 min), respective annealing temperatures (for 45 s) (Table 3), and final extension at 72 °C for 7 min. Bi-directional DNA sequencing reaction of PCR amplicon was carried out with 8F and 1491R primers using BDT v3.1 Cycle sequencing kit on ABI 3730xl Genetic Analyzer. The consensus sequences generated from forward and reverse sequences were aligned with BioEdit v7.0.5 (https://bioedit.software.informer.com/7.2/). The BLAST alignment search of the sequences was carried out from the Ezbiocloud server (https://www.ezbiocloud.net/identify), and based on the maximum identity score, the first fifteen sequences were selected and aligned using multiple alignment software program ClustalW (https://www.genome.jp/tools-bin/clustalw). The distance matrix was generated using the RDP database, and the phylogenetic tree was constructed by the neighbour-joining method using MEGA7 [36]. Relationship stability was assessed by bootstrap analysis of 1000 interactions, and Escherichia coli strain ATCC 35469 (KP941759) was taken as an outgroup during phylogenetic analysis. The species-specific identification of the strains, two housekeeping genes such as elongation factor Tu (Ef-Tu-F and Ef-Tu-R) and enolase (Eno-F and Eno-R) [32] (Table 3), were sequenced, and the BLAST was run through the NCBI database. The maximum likelihood phylogenetic tree was constructed for species identification by multilocus sequence analysis of 16S rRNA, Ef-Tu, and enolase genes using MEGA7 and their multilocus sequence alignment coefficient (MLSA coefficient) were recorded. Further subspecies identification was done using LcLspp-F and Lc-R primer sets [33, 34] (Table 3), and the BLAST analysis were run using the NCBI database. The neighbour-joining tree of the subspecies level was constructed using MEGA7 software.

Table 2.

Morphobiochemical characteristics of the LAB strains

Characteristics	LAB-17	LAB B1.1
Morphological characteristics
Colony morphology	Small, whitish creamy, round smooth in outline	Small, whitish, round, smooth in outline
Cell size (μm)	2.8–3.1 × 1.07–1.09	2.4–2.6 × 1.02–1.07
Cell shape	Coccus, 2 cells in a chain	Coccus, 3–5 cells in a chain
Gram nature	Gram-positive	Gram-positive
Motility	Non-motile	Non-motile
Spore formation	Nil	Nil
Carbohydrate fermentation profile
Adonitol	+  +	+  +
Arabitol	-	+
Cellobiose	+  +	+  +  +
D-arabinose	-	+
Esculin hydrolysis	+  +  +	+  +  +
Malonate utilization	-	+
Mannitol	+	+  +
Melezitose	+	+  +  +
Rhamnose	-	+
Sorbitol	+  +	+  +
Sorbose	-	+
Xylitol	-	+
α-Methyl-D-mannoside	+	+
Biochemical tests
Catalase	-	-
Urease	+	+
Gas production	-	-
Starch hydrolysis	-	-
Growth in anaerobic condition	+	+
Optimum growth temperature	37 °C	37 °C

Here, ‘ + ’ indicates the positive response, and ‘-’ indicates the negative response after 48 h of incubation at 37 °C

Table 3.

The primers used in this study

S. No	Primer sequences	Annealing temperature (°C)	References
1	8-F (5′AGAGTTTGATCCTGGCTCAG3′)	49	Rivas et al. [31]
2	1491-R (5′GGTTACCTTGTTACGACTT3′)
3	Eno-F (5′-CTACCTTGGCGGATTCAACG-3′)	62.5	Turpin et al. [32]
4	Eno-R (5 ′-CGCAAAACCACCTTCGTCAC-3′)
5	Ef-Tu-F (5′-TCGATGCTGCTCCAGAAGAAA-3′)	61.5
6	Ef-Tu-R (5′-TGGCATAGGACCATCAGTTGC-3′)
7	SrtA-F (5′-ATGGGGCARGGTAACTACGC-3′)	56.5
8	SrtA-R (5 ′-GCCCCGGTMTYATCACAGGT-3′)
9	LcLspp-F (5′- GTTGTATTAGCTAGTTGGTGAGGTAAA-3′)	56	Pu et al. [33]; de Freitas Martins et al. [34]
10	Lc-R (5′-GTTGAGCCACTGCCTTTTAC-3′)

In vitro probiotic properties of the strains

Acidic pH tolerance

The low pH tolerance of the LAB strains was studied according to Brashears et al. [37] and Huang et al. [38]. The LAB strains were cultured in MRS broth (pH 6.8 ± 0.2) for 24 h at 37 °C. The cells were then harvested by centrifugation at 4032 × g at 4 °C for 10 min and were resuspended in a sterile 0.85% NaCl (w/v) solution of pH 2.5 adjusted with 1 M HCl incubated at 37 °C for 4 h. The number of surviving cells was determined by counting the CFU/mL on MRS agar plates at every 1 h interval. Survivability of each strain in the saline solution at pH 6.0 was used as a control.

Tolerance to simulated gastric and pancreatic juices

Determination of the transit tolerance of the strains through simulated gastric juice was done following the method of Charteris et al. [39] with slight modifications. Simulated gastric juice was prepared freshly by suspending pepsin (0.3%, w/v, SRL, Mumbai, India) in sterile NaCl solution (0.5% w/v) adjusted to pH 2.0 and 3.0 with 5% o-phosphoric acid and 5(N) NaOH solutions. Overnight cultures were grown in Elliker broth (EB, pH 6.0; 10 mL), centrifuged (7168 × g, 50 min, at 4 °C), washed twice in 100 mM phosphate-buffered saline (PBS, pH 7.0), and resuspended in 2 mL of the same buffer, and an approximate cell density of 0.6 at 610 nm kept at 4 °C until further use. A 200 μL of washed cell suspension was resuspended in 1.0 mL of gastric solution (pH 2.0 and 3.0), vortexed thoroughly for 30 s, and incubated at 37 °C. Total viable counts were done by serial decimal dilution at 0 h, 3 h, and 6 h incubation times grown on Elliker agar plates at 37 °C for 24 h. The results were expressed as the difference in these colony counts (log CFU/mL).

Determination of the transit tolerance of the strains through simulated pancreatic juice was done following the method of Vinderola and Reinheimer [40] with slight modifications. The active cell suspension (0.2 mL) of the strains, as mentioned above, was admixtured in 1.0 mL of freshly prepared pancreatin (0.1%, w/v, SRL, Mumbai, India) in sterile NaCl solution (0.5%, w/v) adjusted to pH 8.0. Simultaneously, 200 μL of the cells were suspended in freshly prepared 1.0 mL of freshly prepared pancreatin (0.1%, w/v, SRL, Mumbai, India) and 0.5 mL of sodium caseinate (final concentration 1 g/L, SRL, Mumbai, India) in 0.5% NaCl solution and pH 8.0 and vortexed vigorously for 30 s. The preparation was incubated at 37 °C for 6 h, and the total viable counts were done at 0 h, 3 h, and 6 h incubation times grown on Elliker agar plates at 37 °C for 24 h. The results were expressed as the difference in these colony counts (log CFU/mL).

Autoaggregation and co-aggregation assays

For autoaggregation, 500 μL of aliquots of each species grown in EB and washed cell suspension in 100 mM PBS was added into separate cuvettes and incubated at room temperature, and absorbance was read at 610 nm for 24 h. For co-aggregation, both the LABs and Gram-positive and Gram-negative strains, grown in nutrient broth (NB), were admixtured at a 1:1 ratio (vol/vol) and observed similar to the autoaggregation study. The decline in the optical density of the bacterial suspensions with time was used to measure autoaggregation or co-aggregation. Per cent autoaggregation or co-aggregation was calculated as follows: % autoaggregation or co-aggregation: Abs[(time zero value—sample value at time t)/ time zero value] × 100.

Hydrophobicity assay

The hydrophobicity was determined according to the method of Vinderola and Reinheimer [40] with some modifications. Active cultures of the strains were harvested in the mid stationary phase by centrifugation at 7168 × g for 5 min at 4 °C, washed twice in 100 mM PBS (pH 7.0), and finally resuspended in the same buffer. The cell suspension was adjusted to O.D. 0.6 at 610 nm value with the same buffer. To a 1 mL of PBS, 500 μl of the bacterial suspensions were added and put in contact with 0.5 mL of n-hexane and xylene vortexed for 120 s. The two phases were allowed to separate for 12 h at 37 °C. The absorbance of the aqueous phase was measured at 610 nm. The decrease/increase in the absorbance of the aqueous phase was taken as a measure of the cell surface hydrophobicity (H%), which was calculated with the formula:

$$\mathrm{H}\%=[\left(A_0,-,A\right)/A_0]100$$

where A₀ and A are the absorbances before and after extraction with n-hexane/xylene, respectively.

Haemolytic activity and Antibiotic sensitivity studies

The haemolytic activity of the strains was done by streaking the strains on the ready-made Sheep Blood Agar plate (HiMedia, MP1301, Mumbai, India) (comprising casein enzymic hydrolysate 14.00; a peptic digest of animal tissue 4.50; yeast extract 4.50; sodium chloride 5.00; agar 12.50; sheep blood 5.00; g/L, final pH 7.3 ± 0.2 at 25 °C) and observed for the clear, colourless zone (beta haemolysis), or greenish zone around the colonies (alpha haemolysis) or no haemolysis/no change in the medium (gamma haemolysis). The haemolytic property was compared with the positive beta haemolytic strain, Streptococcus mutans MTCC 890, and negative controls, Enterococcus faecalis MB1 and Staphylococcus aureus MTCC 96. Antibiotic sensitivities of the strains were screened against 48 nos. preloaded antibiotic octodiscs (HiMedia, Mumbai, India) of different antibiotic classes (Table 4). A 100 μL of overnight growth bacterial cultures were aseptically lawned on an MRS agar plate. The sterile octodiscs (HiMedia, Mumbai, India) were then placed on the bacterial lawn, incubated at 37 °C for 24 h. The strains’ antibiotic sensitivity was determined by measuring the growth inhibition zone and sensitivity, and resistance was inferred by comparing the manufacturer's standard chart.

Table 4.

Antibiotic sensitivity profile of the LAB strains

Name of the antibiotic	LAB-17	LAB B 1.1	Name of the antibiotic	LAB-17	LAB B 1.1
Amikacin (AMK) 10 μg/mL	R	S	Ticarcillin (TIC) 75 μg/mL	S	S
Amoxicillin (AMOX) 30 μg/mL	S	S	Penicillin V (PcV) 10 μg/mL	S	S
Carbenicillin (CAR) 100 μg/mL	S	S	Gentamycin (GEN) 10 μg/mL	S	S
Cephotaxime (ctx) 30 μg/mL	S	R	Lincomycin (LCM) 2 μg/mL	S	S
Chloramphencol (CHL) 30 μg/mL	S	S	Cephalothin (CEP) 30 μg/mL	S	R
Ciprofloxacin (CIP) 10 μg/mL	S	S	Cephalexin (LEX) 30 μg/mL	S	S
Co-trimazine (CTM) 25 μg/mL	R	R	Trimethoprim (TMP) 1.25 μg/mL	S	R
Erythromycin (ERY) 15 μg/mL	S	S	Oxacilin (OXA) 1 μg/mL	S	S
Kanamycin (KAN) 30 μg/mL	R	R	Sulfamethoxazole (SXT) 25 μg/mL	R	R
Nitrofurantoin (NIT) 300 μg/mL	S	S	Colistin methane sulphonate (CST) 25 μg/mL	R	R
Norfloxacin (NOR) 10 μg/mL	R	R	Cephaloridine (LOR) 30 μg/mL	S	S
Oleandomycin (OLE) 15 μg/mL	S	S	Clendamycin (CLI) 2 μg/mL	S	S
Streptomycin (STR) 10 μg/mL	R	R	Ampicillin (AMP) 10 μg/mL	S	S
Sulphonamides sulphatriad (SST) 200 μg/mL	S	S	Methicillin (MET) 5 μg/mL	S	S
Tetracycline (TET) 30 μg/mL	S	S	Tobramycin (TOB) 10 μg/mL	S	S
Vancomycin (VAN) 30 μg/mL	S	S	Penicillin -G (PEN) 10 μg/mL	S	S

S sensitive, R resistant

Cholesterol removal potentiality of the strains in the presence of prebiotics

The strains were inoculated (1%, v/v) into freshly prepared MRS broth supplemented with 0.2% (w/v) sodium thioglycollate (HiMedia, Mumbai, India) amended with prebiotic (inulin) at 10 mg/mL conc. and autoclave sterilized. The filter-sterilized cholesterol solution was added to the respective broth to a final concentration of 100 μg/mL. The cultures were incubated under the anaerobic condition at 37 °C for 24 h in an anaerobic jar with a candle flame. The cell-free supernatant was collected by centrifugation at 7168 × g for 10 min at 4 °C. According to Rudel and Morris’ method [41] and Mandal et al. [42], the amount of cholesterol in the spent broth was determined.

Detection of probiotic genes by PCR amplification

The presence of probiotic genes such as enolase (Eno-F and Eno-R) and sortaseA (SrtA-F and SrtA-R) in the genomic DNA of LAB-17 and LAB-B1.1 were also detected by PCR amplification using specific primers (Table 3). PCR amplifications were carried out in 25 μL volumes with previously described PCR cycles. The amplified products were resolved on 1% agarose gel.

In vivo probiotic efficiency studies

Animal model

Five male Swiss albino mice with an average body weight ~ 40 g were taken in each group for in vivo experimentation. They were maintained in polypropylene cages in an animal house and were monitored under the Institutional Animal Ethics Committee hosted in the Department of Zoology, Visva-Bharati University, India (vide Ref. No.: IACE/VB/2018/6; Dated: 24–04-2018) [43, 44]. The experimental sets were designed with different treatment parameters, viz. (i) control (without probiotic and prebiotic); (ii) treated with LAB B1.1; (iii) treated with LAB-17; (iv) treated with LAB mix; (v) treated with prebiotic inulin; (vi) treated with LAB mix and inulin; and (vii) treated with commercial probiotic and prebiotic consortia (comprising of Lactobacillus acidophilus (CUL 60), Lact. acidophilus (CUL 21), Lact. rhamnosus (CUL 63), Lact. salivarius (CUL 61), Lact. plantarum (CUL 66), Bifidobacterium animalis subsp. lactis (CUL 34), B. bifidum (CUL 20), and Streptococcus thermophilus (CUL 68) (10 billion active cultures), with 100 mg fructooligosaccharides per gelatin-coated capsule, GNC probiotic complex, USA (https://www.gnc.com/probiotics/424640.html). The mice were fed with a regular diet (containing wheat flour, gram flour, table salts, 1:1:0.001, w/w) for 30 days. The prebiotic inulin was fed to a specific experimental set at a dose of 40 mg/Kg body weight/day with or without the new culture of probiotic LAB strains (LAB-17 and LAB B1.1) having ~ 10⁸ CFU/ mL each per day. The commercial probiotic and prebiotic mixture was fed to a particular group as per the recommended dose of the product’s probiotic application. The average body weight of each treatment group, feeding habits, and feeding conditions were monitored on the 0th, 7th, 15th, and 30th days of treatment.

Blood sugar and serum lipid profile

After 30 days of treatment, the blood was collected by cardiac puncture from the overnight fasting mice sacrificed by mild chloroform anaesthesia, and the blood sugar level was determined by glucose oxidase (GOD) and peroxidase (POD) (GOD-POD) method by Siemens Analyser Kit (Ref-28558); total serum cholesterol, total triglycerides, HDL, LDL, and VLDL levels were quantified following the standard protocol using Avantor RFCL Kit (Ref-83LS100-60) [30, 43, 44].

Mammalian toxicity

The liver toxicity was checked by estimating two liver enzymes, viz. serum glutamic pyruvic transaminase (SGPT) and serum glutamic oxaloacetic transaminase (SGOT), using Autospan Kit (Ref-PTC025). The renal toxicity was determined by estimating the blood creatinine using Avantor RFCL Kit (Ref-15000777) [45].

Gut immune response

The serum Immunoglobulin A was measured using Abcam’s IgA ELISA Kit (Ref- ab196263) to determine the gastric immune response to the probiotic strains alone or in combination with prebiotic inulin and compared with commercial probiotic-prebiotic consortia treatment [46].

The gut colonization efficiency of the strains

Scanning electron microscopy was performed to examine gut colonization of the probiotic LAB strains to the mice intestine after selective feeding of the probiotic strains alone or in combination with prebiotic inulin. For this purpose, the upper part of the small intestine (jejunum) was cut and washed with sterile 50 mM phosphate buffer saline (pH 7.0) and prepared for field emission scanning electron microscope (FESEM) study [43, 44] with slight modification. The samples were prefixed with 2% (v/v) glutaraldehyde and 5% dimethyl sulphoxide (DMSO, v/v) in 50 mM Na-P buffer (pH 6.5) for 30 min. After pre-fixation, the samples were washed with the same buffer, followed by dehydration in a series of acetone grades starting from 20 to 100% (v/v) 20 min in each step. The samples were platinum-coated (thickness 2–5 nm) and observed under FESEM (Zeiss Evo 18, Germany).

Statistical analysis

To determine the difference between treatment groups, one-way-ANOVA (For normally distributed data) and Kruskal–Wallis test (For data not normally distributed) were used. For interaction study between parameters, we used a two-way ANOVA. Analysis was done using R 4.1.0 software (https://www.r-project.org), and all the codes were run in Rstudio 1.2.5042 environment (https://www.rstudio.com). The box plots and PCA were made using the Past (4.0.1) software.

Results

Biochemical and molecular characterization of putative probiotic LAB strains

Both the LAB strains showed coccoid cells in pairs or short chains under SEM (Fig. 1a and b). Both the strains have unique biochemical and carbohydrate fermentation profiles, as shown in Table 2. The strains did not produce gas during sugar fermentation, indicating their homofermentative nature. The strains could also tolerate anaerobic growth conditions and were able to utilize adonitol, cellobiose, dextrose, dulcitol, fructose, galactose, inulin, lactose, L-arabinose, maltose, mannitol, mannose, melezitose, melibiose, raffinose, salicin, sorbitol, sucrose, trehalose, and xylose with a great extent. However, both strains failed to utilize citrate, erythritol, glycerol, inositol, ONPG, and α-methyl-D-glucoside. A moderate to minimum utilization was found for α-methyl-D-mannoside and sodium gluconate. Also, LAB B1.1 could utilize arabitol, D-arabinose, malonate, rhamnose, sorbose, and xylitol (Table 2). The LAB strains’ utilization of various mono-, di-, and oligosaccharide sources show their well-defined carbohydrate metabolic network. Based on 16S rRNA sequence homologies and subsequent phylogenetic analysis, it was found that the isolates LAB-17 and LAB B1.1 showed 99.86% and 98.55% similarity with Lactococcus lactis subsp. hordniae (Ezbiocloud accession no. BCVL01000058) and Lactococcus lactis subsp. lactis (Ezbiocloud accession no. BALX01000047), respectively. But the neighbour-joining alignment showed that both the strains LAB-17 and LAB B1.1 were close towards the Lactococcus lactis subsp. lactis (Ezbiocloud accession no. BALX01000047) with bootstrap values of 54 and 67, respectively (Fig. 1c). This result was re-validated, and the identification of species was confirmed by the MLSA analysis of 16S rRNA (MK215681 and MK215683), Ef-Tu (OL789878 and OL789879), and enolase (OL439780 and OL439781) sequences of LAB-17 and LAB-B1.1 respectively. The MLSA study also showed that both strains belong to the Lactococcus lactis with the MLSA coefficient of 0.768 (Fig. S2). The subspecies of the strains LAB-17 and LAB-B1.1 were also identified as Lactococcus lactis subsp. lactis with 100% sequence similarity with the neighbouring Lactococcus lactis subsp. lactis strains (Fig. 1d) with the GenBank accession no. OL404961 and OL405129, respectively. Thus, both these Kinema isolates were identified as Lactococcus lactis subsp. lactis with their respective strain designation as L. lactis subsp. lactis LAB-17 and L. lactis subsp. lactis LAB B1.1, respectively.

Fig. 1.

SEM photo-micrographs and the phylogenetic positions of the strains by the neighbour-joining method. a LAB 17; b LAB B 1.1; and c,d phylogenetic position. In (c) and (d), the present strains have been marked with the symbol ‘triangle’ with GenBank Ac. No. in the bracket, the bootstrap values have been marked at the base of the clade

In vitro probiotic potentialities of the LAB strains

Acidic pH tolerance

The in vitro low pH tolerance of both the LAB strains showed that they could tolerate low pH up to 3 h (Fig. 2a) with ~ 10⁸ CFU/mL, but after 3 h, the CFU count decreased compared to control. Among the strains, the strain LAB-17 had better low pH tolerance than the LAB B1.1. This study indicates that the acidic gastric pH tolerant strains may be suitable for their oral administration. According to one-way ANOVA, there is significant difference in low pH tolerance between LAB-17 (control), LAB-17, LAB B1.1 (control), and LAB B1.1 (p = 0.00035, DF = 3) (Fig. 2c).

Fig. 2.

Effect of low pH and simulated gastric juices on cell viability. a Low pH tolerance; b simulated gastric juices tolerance; c one-way ANOVA analysis of low pH tolerance; and d one-way ANOVA analysis of gastric passage tolerance. Here, the values are the average of triplicate trials ± SE

Tolerance to simulated gastric and pancreatic juices and effect of milk protein on the viability

The tolerance to gastric and pancreatic pH conditions at pH 2.0, 3.0, and 8.0 for 6 h showed that both the strains had a significant reduction in CFU/ml values at pH 2.0; however, at pH 3.0 and 8.0, there was no such sharp decrease in CFU/ml values indicating their gastric and pancreatic pH tolerance (Fig. 2b). The effect of milk protein (Casein) addition on viability during simulated gastric transit showed that casein addition had improved the simulated gastric transit tolerance (Fig. 2b). According to one-way ANOVA, there is a significant difference in gastric transit tolerance between pepsin (pH 2.0), pepsin (pH 3.0), pancreatine (pH 8.0), pancreatine + Sod. caseinate (pH 8.0) (p = 0.00672, DF = 3) (Fig. 2d).

Autoaggregation, co-aggregation, and hydrophobicity assays

The strains had autoaggregation ranging from 15 to 25% over 24 h and had a significant co-aggregation with both LAB and Gram-positive and Gram-negative bacterial strains related to human illness (Fig. 3a, c, e). The strains also showed solvent and media-specific hydrophobicity against n-hexane and xylene (Fig. 3g). According to one-way ANOVA (Fig. 3b), there is a significant difference in aggregation between TGY and EB (p = 8.28e-07, DF = 1). According to one-way ANOVA and Kruskal–Wallis test, there is no overall significant difference in co-aggregation between all the test groups (p = 0.84, DF = 9; p = 0.959, DF = 9) (Fig. 3d, f). According to one-way ANOVA, there is no significant difference in hydrophobicity between the strains in both the solvents, while it has significant difference between TGY, EB (+ Lactose) and EB (- Lactose) in xylene solvent only (p = 0.014, DF = 2) (Fig. 3h).

Fig. 3.

Autoaggregation, co-aggregation, and cell wall hydrophobicity assays. a Autoaggregation; b one-way ANOVA analysis of autoaggregation; c co-aggregation of LAB B1.1; d one-way ANOVA analysis and Kruskal–Wallis test of co-aggregation of LAB B1.1; e co-aggregation of LAB-17; f one-way ANOVA analysis and Kruskal–Wallis test of co-aggregation of LAB-17; g cell wall hydrophobicity; and h one-way ANOVA analysis of cell wall hydrophobicity. Here, the values are the average of triplicate trials ± SE

Haemolytic and antibiotic sensitivity studies

The haemolytic activity of the strains showed that none of the stains caused a change in the medium (Fig. S3), indicating their non-haemolytic property. The antibiotic sensitivity profiling showed that both the strains were found sensitive to beta-lactum antibiotics like amoxicillin and methicillin while resistant to co-trimazine, kanamycin, streptomycin, norfloxacin, sulfamethoxazole, and colistin methane sulphonate in their respective treatment dose (Table 4). Moreover, the strain LAB-17 was resistant against amikacin, and LAB B1.1 was resistant to cephotaxime, trimethoprim, and cephalothin. This antibiotic resistance property of the LAB strains against some common antibiotics indicates their stability to survive in the host’s gut during treatment with those antibiotics.

Antimicrobial spectrum study

Both the strains showed good antibacterial and antifungal activities against all pathogenic and food spoilage bacteria and fungi tested (Table 1 and Fig. S4). There was no significant change in the growth inhibition zone of both the non-heat treated and heat-treated culture aliquots against the bacteria tested, except for Escherichia coli MTCC1667, indicating their heat-stable bacteriocin nature. The antifungal assessment shows that the strains have potential activity against all pathogenic and food spoilage fungi tested. Subsequent isolation and characterization of the antifungal compound would decipher some potent antifungal compounds from these strains for their antifungal applications.

In vitro cholesterol removal potentiality of the strains

The result showed that both the LAB strains could effectively remove cholesterol from the culture broth (Fig. S4). It was found that the treatment reduced the cholesterol content by 42.91% and 41.75% for LAB-17 and LAB B1.1, respectively, compared to the untreated control. Data revealed that LAB-17 was much potent in removing cholesterol when compared to LAB B1.1. Thus, the in vitro result signifies that the selected LAB strains could reduce serum cholesterol using in vivo treatment models.

Detection of probiotic genes by PCR amplification

The PCR amplification of the probiotic genes (enolase and sortaseA) (Fig. S5) showed the presence of a distinct band of enolase near the 200 bp region in both the LAB-17 and LAB B1.1 strains, whereas no PCR amplification bands were observed for sortaseA gene (Fig. S5). Thus, the molecular marker study also proves their probiotic potentiality. 

In vivo probiotic potentials of the LAB strains in Swiss Albino mice model

Influence on body weight, health attributes, mammalian toxicity, and statistical significance

All the experimental mice sets (control and treated) did not show any sign of allergenic lesion, sickness, and unusual stool and urine discharge and appeared healthy and fit throughout the feeding experimentation, indicating their non-toxicity on the animal model. Similar physiological parameters were also observed for the commercial probiotic and prebiotic consortium treatment. Despite any significant differences in total food intake among the mice, the growth (body weight) was better in the treatment sets than in the control. The weight gain was maximum in the synbiotic setup comprising probiotics and prebiotics (synbiotics) consortium, i.e., LAB-17, LAB B1.1, and inulin, and was comparable to the commercial synbiotic (Fig. 4a). The blood sugar level was average in all treatment sets, indicating that the prebiotic amendments did not significantly affect the blood sugar level. LAB-17 and LAB B1.1 in combination significantly lowered (1.077 times) the cholesterol profile compared to untreated control, and their efficacy increased when feeding along with commercial prebiotic inulin, which is comparable to treatment set with commercial probiotic-prebiotics consortium. On the other hand, the serum HDL levels were increased significantly (1.142 times) in all the treatment cases compared to their untreated controls.

Fig. 4.

In vivo health attributes of probiotic, probiotic-inulin, and commercial probiotic-prebiotic consortium treatments after 30 days. a The box-jitter plot; b the principal component analysis (PCA), and c the quantitative IgA level. Here, the colour codes in (a) have been labelled on the right side of the figure; and in (b), the health parameters are marked inside the figure

Mammalian toxicity tests performed by measuring the serum SGPT and SGOT level in the blood samples of mice treated with LAB-17 and LAB B1.1 with/without inulin showed that these two enzymes’ levels remained almost the same or slightly decreased than untreated control set, indicating the non-toxic nature of the probiotics. Like the serum creatinine level in the treated sets, the renal toxicity test showed no significant changes than the untreated test (Fig. 4a). A high serum SGPT and SGOT and creatinine level in the blood signify liver toxicity and kidney dysfunction, respectively [44, 45].

The principal component analysis (PCA) of the health profiles with probiotic, prebiotic, and synbiotic factors among the inter-group correlations is shown in Fig. 4b. The figure shows that the SGPT, SGOT, and creatinine represent one correlating group and, on the same side, serum cholesterol, LDL, VLDL, and triglycerides represent another correlating group. The data combination expression did not change or slightly decrease serum creatinine, SGPT, and SGOT, indicating the LAB strains’ non-toxic nature compared to inulin set, commercial pro-prebiotic, and control set. The LAB strains significantly decreased the serum cholesterol, LDL, VLDL, and triglycerides in all experimental sets than the control correlatively, indicating their hypocholesterolemic activity. HDL level and average weight gain on the opposite face indicate that their increased amount in all experimental sets relates to the benefit of health. Blood sugar does not correlate to the other distantly placed groups, but no abrupt change or slightly decreased blood sugar level has been observed proved their hypoglycaemic effect. These results indicated the non-toxic and health-beneficial probiotics that could be trialled for their human consumption and synbiotic therapy following the standard guideline.

Effect on immunoglobulin A (Ig A) level

Ig A is the principal immunoglobulin of the mucus membrane system conferring protection against an enumerable immunogenic foreign component. A stable change in the IgA values indicates the gut immune response towards such foreign compounds. It has been reported that live bacterial supplements and or with prebiotics trigger the IgA values. The IgA levels in the different treated sets (Fig. 4c) show that IgA had increased in the set of mice treated with probiotic LABs mix, probiotic LABs with inulin, and commercial pro-prebiotic consortium. Synbiotic combinations of probiotics (LAB-17 & LAB B1.1) with inulin resulted in a significant increase in IgA level comparable with market-borne commercial probiotics and prebiotic consortium. Hence, the findings presented in this study indicate the immune enhancement efficiency of these two probiotic strains that either alone or with prebiotics may substitute the established commercial synbiotics for future use.

In vivo adherence of the probiotic LAB strains to the mice intestine

The bacterial strains must survive and colonize in the intestine of the host body to exert the probiotic effects [42, 47]. Therefore, adhesion to the mucosal surfaces of the small intestine, where the flow rates are comparatively high, is considered an essential criterion for colonization of any probiotic strain [48]. SEM analyses of various sets of treated mice intestine explored the significant bacterial colonization of the targeted probiotic strains in the Swiss albino mice (Fig. 5). In probiotic treatment sets, either with LAB-17 (Fig. 5b) or LAB B1.1 (Fig. 5c) or both LAB-17 and LAB B1.1 mix (Fig. 5d), where the maximum colonization of LAB was found. However, administration of LAB mix with prebiotic inulin did not alter the gut colonization significantly (Fig. 5e), which is comparable with commercial synbiotics (Fig. 5f). This indicates that suitable prebiotics imparts the blood and serum profile but are not essential for the probiotic strains’ colonization behaviour.

Fig. 5.

FESEM photomicrographs of the mice intestine treated with different probiotics after 30 days of treatment. a Control without any probiotics; treated with b L. lactis subsp. lactis LAB-17; c L. lactis subsp. lactis LAB B1.1; d both strains; e both strains along with inulin feed; and f commercial probiotic-prebiotic consortium. Here, the arrow mark sections reflect the gut colonization by the strains

Discussion

Lactococcus spp. are crucial fermenting microbes for manufacturing cheeses such as cheddar; Colby; cottage cheese; cream cheese; Camembert; Roquefort; and brie; and other dairy products like cultured butter, buttermilk, sour cream, and kefir [48]. It is also helpful for vegetable fermentation, such as cucumber pickles and sauerkraut. Due to their versatile metabolites production having antimicrobial properties, contributing to the quality attributes of food products during fermentation, they are crucial microbes used as a starter culture. Therefore, finding new and novel strains with starter culture property and food preservation efficiency could contribute to industrial applications. Kinema is an ethnic, non-salted, and sticky fermented soybean food of India and is consumed in India’s eastern part. It harbours the most prevalent microorganisms such as Bacillus amyloliquefaciens, B. licheniformis, B. pumilus, B. subtilis, Corynebacterium glutamicum, Lb. plantarum, and L. lactis [49]. It serves as a low-cost source of protein in the diet of the people of the Himalayas. The naturally fermenting Bacillus strains have been extensively worked out for the production of poly-γ-glutamic acid (PGA) [50], bioactive hydrolysate like protease, β-glucosidase and α-amylase activities, and biosurfactants [51], while Lb. plantarum has been used for bacteriocin production [52]. However, the strains of L. lactis have not worked out for their bacteriocin production and health-beneficial probiotic properties. The present strains, L. lactis LAB-17 and L. lactis LAB B1.1, the Kinema isolates [53], (belonging to the phylum Firmicutes, class Bacilli, Order Lactobacillales, and Family Streptococcaceae) showed the fermentation efficiency of a wide range of carbohydrates and broad-spectrum antibacterial and antifungal activity. This focuses on their potential applications in fermenting vegetables. In addition to this, it has been reported that certain non-dairy L. lactis strains could also exhibit flavour-forming traits to dairy fermentation. Therefore, these strains could also be assessed in their dairy applications.

Probiotics provide an alternative method to treat intestinal infection disease caused by antibiotic-resistant bacteria. In a study, Plupjeen et al. [54] showed that the probiotic L. lactis KA-FF 1–4 has a potent inhibitory action on the growth of Vancomycin-resistant enterococci (VRE) by producing antimicrobial substances. Moreover, it could positively modulate the gut microbiota by promoting beneficial microbes and their metabolites. Dowdell et al. [26] isolated an L. lactis strain from Thai fermented sausages with probiotic properties active against Clostridium difficile. The isolate could diminish the expression level of TNF-α and IL-8 induced by the cell-free supernatant of Cl. difficile and thus could improve the gut health by counteracting the Cl. difficile-associated intestinal inflammation. In a study, Zhang et al. [55] reported the effects of exopolysaccharide producing L. lactis subsp. cremoris on the virulence gene expression of Salmonella enterica serovar Typhimurium and observed that in the presence of L. lactis subsp. cremoris the virulence gene expression was down-regulated and lowered the number of invasive bacteria into the host epithelial cells. Therefore, similar challenge studies could explore their multifaceted application in selective probiotic application against pathogen-associated disease complications.

The acid tolerance of microbial cells is a crucial issue for their selection and characterization as probiotic strain. Zhu et al. [56] elucidated that the standard and specific mechanisms underlying improved acid tolerance are accomplished through overexpression of the ABC transporters RbsB and MsmK for increasing intracellular ATP concentrations to protect cells against acid stress. Quantitative real-time PCR analysis showed that there was 2.35-fold increase of the transcription of non-coding small RNA NC-1 at pH 3.0 compared with the control (pH 7.0). Thus, the overexpression assays indicated that small RNA NC-1 could significantly enhance acid tolerance [57]. Jain et al. [58] reported that the strain of L. lactis had good cholesterol assimilation potential during both in vitro and in vivo conditions. Oral administration of milk fermented with selected LAB strains to mice slightly decreased blood cholesterol and increased colonization of total lactobacilli and lactococci. The underlying mechanism for the hypocholesterolemic effect of probiotic bacteria includes deconjugation of bile salts, modulation of lipid metabolism, and decreased intestinal cholesterol absorption. It also co-precipitates intestinal cholesterol with the deconjugated bile salts, incorporation and assimilation of cholesterol in the probiotics’ cell membrane, intestinal conversion of cholesterol in coprostanol, and inhibition of the expression of the intestinal cholesterol transporter Niemann-Pick C1 Like 1 (NPC1L1) in the enterocytes. Thus, it is emphasized that a regular intake of fermented foods with a known probiotic could significantly change the lipid profile and minimize cardiovascular diseases [59]. Bandyopadhyay et al. [53] reported the bile salt hydrolyzing potency of these probiotic L. lactis strains superior to many other probiotic bacteria. Moreover, these strains had significant synbiotic effects on Swiss albino mice with the fructooligosaccharide fraction of traditional root vegetables [43, 44]

Bacterial biofilm formation involves several stages, including adhesion, microcolony formation, maturation, and eventual dispersal. Bacterial adhesion to surfaces is an essential step in colonization and biofilm formation. In comparison, co-aggregation is a crucial phenomenon that facilitates interaction among different bacterial species in the biofilm. The cell wall hydrophobicity of the strains is an important parameter to reflect the cell surface binding ability to heterogeneous surfaces like epithelial cells, matrix binding, surface coatings, etc. Moreover, one of the critical factors that may favour beneficial bacteria’s health effects on the host is their capacity to colonize the gut transiently, notably through close interaction with mucus, which covers and protects the intestinal epithelium. It is hypothesized that the interactions may occur between cell surface protein adhesins and polysaccharide receptors. Sortase A, a key enzyme of the sortase-dependent proteins (SDPs), and enolase are important biomarkers that help in the adhesion of probiotic bacteria to gastric epithelial cells and host immune modulation. The study revealed that both the strains possess the housekeeping enolase gene that could play a role in probiotic binding efficiently [60, 61]. Thus, the study also proves these probiotic properties of the strains at their genomic level. Therefore, L. lactis adhering to the intestinal mucosa can potentially prolong the host’s contact, favouring its persistence in the gut [62]. Park et al. [63] reported that on the first day of an infant’s life, the largest taxonomic group of L. lactis and other species like Enterobacter sp., Leuconostoc citreum, and Streptococcus mitis found to colonize in the gut. Thus, it is evident that L. lactis has some specialization to colonize in the gut. However, the exact mechanism has remained to be adequately resolved. The studies with several L. lactis strains have been shown to exhibit mucus-binding properties, and bacterial surface proteins have been identified as critical determinants of such capacity. Radziwill-Bienkowska et al. [64] showed that the plasmid-encoded factors of the L. lactis subsp. cremoris IBB477 strain encodes cell wall-associated peptidase S8 (PrtP), thus mediating adhesion of the IBB477 strain to bare, mucin fibronectin-coated polystyrene, as well as to HT29-MTX cells. Apart from the human immune modulation response, the probiotic applications of L. lactis also influence the host immune response of other animals. Carvalho et al. [65] also demonstrated that the administration of L. lactis NZ9000 stabilized human gut homeostasis, the pancreatitis-associated protein (PAP). Xia et al. [66] studied the effects of L. lactis subsp. lactis JCM5805 on colonization dynamics of gut microbiota and regulation of immunity in early ontogenetic stages of tilapia fish and found that early microbial exposure of tilapia larvae affects the gut microbiota at later life stages. In a study, Beck et al. [67] also reported that L. lactis BFE920 fed fish showed activated macrophages and dendritic cells and significantly increased regulatory genes’ levels (FOXP3, IL-10, and TGF-β1), CD18, and CD83 in the gut.

Thus, the overall health beneficial and industrial application prospects of L. lactis strains show their ability to serve as GRAS strains. In this context, the present autochthonous strains of L. lactis also could decipher their multifaceted health and fermentation attributes. The selective target-specific applications may prove significant probiotic strains in human endeavour.

Conclusion

Lactococcus sp. is a widespread and well-known genus of LAB known for its potential lactic acid fermentation and bacteriocin production that occurs naturally in a wide range of fermented foods. Despite their significant and beneficial role in the dairy industry, commercial exploitation as a probiotic supplement is significantly low compared to other genera, specifically Lactobacilli (Fig. S1). Both fermented foodborne L. lactis subsp. lactis LAB-17 and L. lactis subsp. lactis LAB B1.1 with potent in vitro and in vivo hypocholesterolemic and along with broad antimicrobial spectrum against several plants, human pathogenic, and food spoilage pathogens, good bacterial colonization, and IgA mediated gut immunomodulation with significantly lowered TG, LDL, and VLDL cholesterols. It significantly enhanced HDL cholesterol level that proves their health beneficial hypoglycaemic attributes. Thus, these L. lactis subsp. lactis LAB-17 and L. lactis subsp. lactis LAB B1.1 could probably be used as a new possible probiotic combination for future use and many fermented food products.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contribution

All authors contributed to the study’s conception and design. Biplab Bandyopadhyay and Satinath Das performed material preparation, data collection, and analysis. Biplab Bandyopadhyay wrote the first draft of the manuscript, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Conceptualization and design of experimentation: Vivekananda Mandal and Narayan Chandra Mandal. Methodology: Biplab Bandyopadhyay and Satinath Das did the experimentations. Prashanta Kumar Mitra did the statistical analysis and data analysis for its presentation. Ashutosh Kundu and Vivekananda Mandal did the in vitro probiotic studies. Rajsekhar Adhikary did the detailed molecular and phylogenetic characterization of the strains. Formal analysis and investigation: Biplab Bandyopadhyay. Writing-original draft preparation: Biplab Bandyopadhyay. All authors read and approved the final manuscript. All the authors agree to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Writing-review and editing: Vivekananda Mandal and Narayan Chandra Mandal. Supervision: Vivekananda Mandal and Narayan Chandra Mandal. Funding acquisition: No direct funding received for this research work; however, the institutions have provided necessary chemicals and infrastructural facilities to do the experiments.

Data availability

The data has been submitted as a supplementary compressed file along with this article.

Code availability

Not applicable.

Declarations

Ethics approval

The work with the animal model has been conducted as per the Institutional guidelines of the Institutional Animal Ethics Committee hosted in the Department of Zoology, Visva-Bharati University, India (vide Ref. No.: IACE/VB/2018/6; Dated: 24–04-2018).

Consent to participate

Not applicable.

Consent for publication

Not applicable.

Conflict of interest

The authors declare no competing interests.