TABLE 2.
Probe | Specificity | Sequence (5′-3′) of probe | Targeta site (rRNA positions) | % FAb in situ | Reference |
---|---|---|---|---|---|
EUB338 | Bacteria | GCTGCCTCCCGTAGGAGT | 16S (338–355) | 0–35 | 2 |
NON338 | ACTCCTACGGGAGGCAGC | 16S (338–355) | 0–35 | 64 | |
ALF968 | Alpha subclass of Proteobacteria | GGTAAGGTTCTGCGCGTT | 16S (968–986) | 35 | 40 |
BET42a | Beta subclass of Proteobacteria | GCCTTCCCACTTCGTTT | 23S (1027–1043) | 35 | 32 |
GAM42a | Gamma subclass of Proteobacteria | GCCTTCCCACATCGTTT | 23S (1027–1043) | 35 | 32 |
CF319a | Cytophaga-Flavobacterium cluster of CFB phylum | TGGTCCGTGTCTCAGTAC | 16S (319–336) | 35 | 31 |
PLA886 | Planctomycetales | GCCTTGCGACCATACTCCC | 16S (886–904) | 35 | 41 |
ARCH915 | Archaea | GTGCTCCCCCGCCAATTCCT | 16S (915–935) | 20–35 | 58 |
Escherichia coli numbering (9).
Percentage of formamide (FA) in in situ hybridization buffer.