TABLE 1.
A list of 16S rRNA-targeted oligonucleotide probes used in this study
| Probe | Specificity | Sequence of probe (5′-3′) | Target sitea | FAb (%) | NaClc (mM) | Reference(s) |
|---|---|---|---|---|---|---|
| EUB338 | Domain Bacteria | GCTGCCTCCCGTAGGAGT | 338–355 | 20 | 0.166 | 1 |
| SRB385 | SRB of the delta Proteobacteria plus several gram-positive bacteria (e.g., Clostridium spp.) | CGGCGTCGCTGCGTCAGG | 385–402 | 30 | 0.071 | 3, 39 |
| SRB385Db | Family Desulfobacteriaceae (except for Desulfobulbus spp.) plus some non-sulfate-reducing bacteria (e.g., Myxococcus xanthus and Pelobacter acetylenicus) | CGGCGTTGCTGCGTCAGG | 385–402 | 30 | 0.071 | 38 |
| SRB687 | Desulfovibrio spp. plus members of the genera Geobacter, Desulfomonas, Desulfuromonas, Desulfomicrobium, Bilophila, and Pelobacter | TACGGATTTCACTCCT | 687–702 | 10 | 0.386 | 15 |
| SRB660 | Desulfobulbus spp. | GAATTCCACTTTCCCCTCTG | 660–679 | 30 | 0.071 | 15 |
| SRB129 | Desulfobacterium spp. | TGCGCGGACTCATCTTCAAA | 221–240 | 10 | 0.386 | 15 |
| SRB221 | Desulfobacter spp. | CAGGCTTGAAGGCAGATT | 129–146 | 20 | 0.166 | 15 |
a
16S rRNA position according to Escherichia coli numbering.
b
Formamide concentration in the hybridization buffer.
c
Sodium chloride concentration in the washing buffer.