TABLE 1.
16S rRNA oligonucleotide probes and target groups
| Probe | Sequence (5′–3′) | Target sitea | Positive control | Wash temp (°C) | Targeted bacteria |
|---|---|---|---|---|---|
| LGC | TCACGCGGCGTTGCTC | 399 | B. subtilis | 51 | Low-G+C-content gram-positive organismsb |
| Clost I | TTCTTCCTAATCTCTACGCA | 864 | C. magnum | 53 | 88 clostridia of cluster I, 2 clostridia of cluster II |
| AW | GGCTATTCCTTTCCATAGGG | 228 | A. woodii | 52 | 4 Acetobacterium species, E. limosum |
| DSV | TGGGCCGTGTTNCAGT | 344 | D. desulfuricans | 46 | 13 Desulfovibrio species |
a
According to numbering of the Escherichia coli 16S rRNA.
b
The LGC probe targets 104 Bacillus species, 45 Staphylococcus species, 41 Mycoplasma species, 37 Lactobacillus species, 33 Streptococcus species, 25 Paenibacillus species, 15 Brevibacillus species, 11 Sporolactobacillus species, and also some other genera in low numbers.