| RPLP0_fwd | RefSeq ID: NM_001002, reference gene | GGATCTGCTGCATCTGCTTG |
| RPLP0_rev | RefSeq ID: NM_001002, reference gene | GCGACCTGGAAGTCCAACTA |
| 2019‐nCoV_N‐F | qPCR primers for SARS COV2 WHO & CRC recommended | TTA CAA ACA TTG GCC GCA AA |
| 2019‐nCoV_N‐R | qPCR primers for SARS COV2 WHO & CRC recommended | GCG CGA CAT TCC GAA GAA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.