Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
sgRNA detailed information for EphA7 via CRISPR-ERA
| Sequence | Distance to TSS(bp) | Strand | ||
|---|---|---|---|---|
| Acitivation | act-sgRNA1 | GCGCGAGCTCAGAACCTGGA | -209 | + |
| act-sgRNA2 | GGTCCGAGGCAGGAGCCAAT | -150 | - | |
| act-sgRNA3 | GGAATCGCCTCCTGGCAGGC | -78 | + | |
| Repression | rep-sgRNA1 | GCAAGCGGCCGGTCTGCAGT | +33 | + |
| rep-sgRNA2 | GTTTCAGTTATCTTGAGTCG | +216 | - | |
| rep-sgRNA3 | GCCGATCGGGGACCGAGAAG | +130 | + | |
| rep-sgRNA4 | GCAAGTCTCCGACTGCAGAC | +44 | - | |
