| Bacterial and virus strains |
|
B. thetaiotaomicron VPI-5482 - BTWT |
Goodman Lab, Yale University |
|
|
B. thetaiotaomicron VPI-5482 - SLMUT |
Goodman Lab, Yale University |
|
|
B. thetaiotaomicron iSPTΔ1526 |
Ley Lab, Max Planck Institute for Developmental Biology |
|
| Chemicals, peptides, and recombinant proteins |
| Alkynyl palmitic acid |
Click Chemistry Tools |
Cat# 1165–100 |
| 15-Methyl palmitic acid |
Cayman Chemical |
Cat# 24814 |
| Palmitic acid |
MP Biomedicals |
Cat# 02100905-CF |
|
l-Serine |
Sigma-Aldrich |
Cat# S4500 |
|
l-Homoserine |
Carbosynth |
Cat# FH23855 |
|
l-Threonine |
Sigma-Aldrich |
Cat# T8625 |
|
l-Allothreonine |
Carbosynth |
Cat# FA30577 |
| Palmitoyl coenzyme A potassium salt |
Chem Impex |
Cat# 01894 |
| Coenzyme A hydrate |
Chem Impex |
Cat# 00644 |
| Bacto Brain Heart Infusion (BHI) |
Becton Dickinson (BD) |
Cat# 237500 |
| Potassium phosphate monobasic |
Sigma-Aldrich |
Cat# P9791 |
| Sodium chloride |
Sigma-Aldrich |
Cat# S9888 |
| Ammonium sulfate |
Fisher Scientific |
Cat# AC205872500 |
|
d-(+)-Glucose |
Sigma-Aldrich |
Cat# G7021 |
| Sodium hydroxide |
Sigma-Aldrich |
Cat# 221465 |
| Hemin |
Fisher Scientific |
Cat# MP021988202 |
| Magnesium chloride |
Sigma-Aldrich |
Cat# M8266 |
| Iron (II) sulfate heptahydrate |
Sigma-Aldrich |
Cat# 215422 |
| Vitamin K3 (Menadione) |
Cayman Chemical |
Cat# 15950 |
| Calcium chloride |
Sigma-Aldrich |
Cat# C1016 |
| Vitamin B12 |
Sigma-Aldrich |
Cat# V6629 |
|
l-Cysteine hydrochloride |
Sigma-Aldrich |
Cat# C1276 |
| Sodium thioglycolate |
Sigma-Aldrich |
Cat# T0632 |
| AFDye 647 Azide |
Click Chemistry Tools |
Cat# 1299 |
| Click-&-Go Cell Reaction Buffer Kit |
Click Chemistry Tools |
Cat# 1263 |
| Absolute ethanol |
Fisher Scientific |
Cat# BP2818100 |
| Methanol (Optima LC/MS Grade) |
Fisher Scientific |
Cat# A456–500 |
| Water (Optima LC/MS Grade) |
Fisher Scientific |
Cat# W7–4 |
| Acetonitrile (Optima LC/MS Grade) |
Fisher Scientific |
Cat# A996–1 |
| Formic Acid, 99.0+%, Optima LC/MS Grade |
Fisher Scientific |
Cat# A117–50 |
| 1.0 mm Zirconium Beads, Pre-Filled Tubes |
OPS Diagnostics |
N/A |
| Tissue-Tek O.C.T. Compound |
VWR |
Cat# 25608–930 |
| Tissue-Tek Cryomold |
VWR |
Cat# 25608–916 |
| RIPA buffer |
Thermo Fisher Scientific |
Cat# 89900 |
| DC protein assay |
Bio-Rad |
Cat# 5000112 |
| High-Capacity cDNA Reverse Transcription Kit |
Thermo Fisher Scientific |
Cat# 4368814 |
| Power SYBR Green Master Mix |
Thermo Fisher Scientific |
Cat# 4368706 |
| Nickel NTA Agarose Beads |
Gold Biotechnology |
Cat# H-350–5 |
| ProBlock Gold Bacterial 2D Protease Inhibitor Cocktail |
Gold Biotechnology |
Cat# GB-376–1 |
| IPTG |
Gold Biotechnology |
Cat# I2481C5 |
| Imidazole |
Sigma-Aldrich |
Cat# 56749 |
| Glycerol |
Sigma-Aldrich |
Cat# G5516 |
| Adenosine 5′-triphosphate disodium salt hydrate |
Sigma-Aldrich |
Cat# A2383–5G |
| Pyridoxal 5′-phosphate hydrate |
Sigma-Aldrich |
Cat# P9255 |
| Triton X-100 |
Alfa Aesar |
Cat# A16046-AE |
|
l-SERINE (13C3, 99%; 15N, 99%) |
Cambridge Isotopes |
Cat# CNLM-474-H-0.1 |
|
l-THREONINE (13C4, 97–99%) |
Cambridge Isotopes |
Cat# CLM-2261–0.1 |
|
l-ASPARTIC ACID (13C4, 99%; 15N, 99%) |
Cambridge Isotopes |
Cat# CNLM-544-H-0.25 |
| GLYCINE (13C2, 99%; 15N, 99%) |
Cambridge Isotopes |
Cat# CNLM-1673-H-0.25 |
|
l-CYSTEINE (13C3, 99%; 15N, 99%) |
Cambridge Isotopes |
Cat# CNLM-3871-H-0.1 |
| L-METHIONINE (13C5, 99%) |
Cambridge Isotopes |
Cat# CLM-893-H-0.05 |
| Eagle’s Minimum Essential Medium (EMEM) |
ATCC |
Cat# 302003 |
| Glucose-free DMEM |
Thermo Fisher Scientific |
Cat# A1443001 |
| Trypsin |
Sigma-Aldrich |
Cat# T8003 |
| GlutaMAX |
Sigma-Aldrich |
Cat# 35050061 |
| Sucrose |
VWR |
Cat# 470302–808 |
| QuantSeq 3’ mRNA-seq Library Prep Kit |
Lexogen |
https://www.lexogen.com/store/quantseq-3-mrna-seq-library-prep-kits-for-illumina/
|
| Fatty Acid Free BSA |
Sigma-Aldrich |
Cat# A8806 |
| Seahorse XF Base Medium |
Agilent Technologies |
Part# 103335–100 |
| Oligomycin |
Sigma-Aldrich |
Cat# 75351 |
| Carbonyl cyanide 4-(trifluoromethoxy)phenylhydrazone (FCCP) |
Sigma-Aldrich |
Cat# C2920 |
| Rotenone |
Sigma-Aldrich |
Cat# R8875 |
| Antimycin A |
Sigma-Aldrich |
Cat# A8674 |
| Acyl-coenzyme A synthetase from Pseudomonas sp. |
Sigma Aldrich |
Cat# A3352 |
| Acyl-CoA synthetase, recombinant |
Creative Enzymes |
Cat# NATE-1682 |
| BT0870_His6 (SPT) |
This paper |
N/A |
| Deposited data |
| Metabolomic analysis |
This manuscript |
GNPS: MSV000087619 |
| Raw HepG2 RNA sequencing data |
This manuscript |
Sequence Read Archive; SRA data: PRJNA808399 |
| Raw Mouse Liver RNA sequencing data |
This manuscript |
Sequence Read Archive; SRA data: PRJNA808399 |
| Experimental models |
| Swiss Webster Mice |
Taconic Biosciences |
SW-F EF |
| Experimental models: Cell lines |
| Human hepatocellular carcinoma cells (HepG2) |
ATCC |
HB-8065 |
| Oligonucleotides |
| qPCR: Mouse 18S rRNA forward |
Thermo Fisher Scientific |
GTAACCCGTTGAACCCCATT |
| qPCR: Mouse 18S rRNA reverse |
Thermo Fisher Scientific |
CCATCCAATCGGTAGTAGCG |
| qPCR: Mouse CPT1a (liver) forward
|
Thermo Fisher Scientific |
CGTGACGTTGGACGAATC |
| qPCR: Mouse CPT1a (liver) reverse
|
Thermo Fisher Scientific |
TCTGCGTTTATGCCTATC |
| qPCR: Mouse CPT1b (colon) forward
|
Thermo Fisher Scientific |
GCACACCAGGCAGTAGCTTT |
| qPCR: Mouse CPT1b (colon) reverse
|
Thermo Fisher Scientific |
CAGGAGTTGATTCCAGACAGGTA |
| pET21_BT0870_fwd |
This paper |
aattttgtttaactttaagaaggagatatacatATGGGATTATTACAAGAGAAGTTAGCT |
| pET21_BT0870_rev |
This paper |
ggatctcagtggtggtggtggtggtgctcgagCAAAAGGTCTAAAGCTTTGAAAGCTTTC |
| Recombinant DNA |
| Plasmid: pET21-BT0870 |
This paper |
N/A |
| Software and algorithms |
| Metaboseek (Helf et. al. 2022) |
https://github.com/mjhelf/Metaboseek
|
Software version 0.9.6 |
| GraphPad Prism |
https://www.graphpad.com/scientific-software/prism/
|
|
| R software |
https://cran.r-project.org/
|
R version 3.5.1 |
| FastQC |
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
|
Software version 0.11.5 |
| Trimoomatic |
(Bolger et al., 2014) |
|
| DESeq2 package |
(Love et al., 2014) |
|
| GSEA |
Broad Institute http://software.broadinstitute.org/gsea/index.jsp
|
|
| Salmon |
(Patro et al., 2017) |
Software version 0.7.2 |
| pheatmap package |
https://rdrr.io/cran/pheatmap/
|
|
| ImageJ, Fiji |
(Schneider et al., 2012) |
https://imagej.nih.gov/ij/
|
| LAS X LS software Leica Application Suite (LAS) |
https://www.leica-microsystems.com/products/microscope-software/p/leica-las-x-ls/
|
|
| BioRender |
BioRender (2020) |
https://www.biorender.com
|
