|
Antibodies
|
| biotinylated rabbit anti-mouse IgG secondary antibody |
ThermoFisher Scientific |
Cat#31813 |
| mouse high-affinity anti-Strep tag IgG1 monoclonal antibody |
IBA GmbH |
Cat#2-1517-001 |
|
|
|
|
|
|
|
|
|
|
Bacterial and virus strains
|
|
Escherichia coli: BL21-Gold competent cells |
Agilent Technologies |
Cat#230130 |
| Baculovirus Expression System |
Expression Systems |
Cat#91-200 |
|
|
|
|
|
|
|
|
|
|
Biological samples
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Chemicals, peptides, and recombinant proteins
|
| LD555p-MAL |
Lumidyne Technologies |
Cat#03/04 |
| LD655-MAL |
Lumidyne Technologies |
Cat#09/10 |
| SNAP-Surface Alexa Fluor 647 |
New England Biolabs |
Cat#S9136S |
| V2Rpp |
Tufts University peptide synthesis core facility |
N/A |
| V2Rnp |
Tufts University peptide synthesis core facility |
N/A |
| V2Rbp |
Tufts University peptide synthesis core facility |
N/A |
| Biotin-V2Rpp |
Tufts University peptide synthesis core facility |
N/A |
| Heparin |
Sigma-Aldrich |
Cat# H3149-10KU |
| IP6 |
Sigma-Aldrich |
Cat#407125 |
| diC8-PI(4,5)P2 |
Echleon Biosciences |
Cat#P-4508 |
| Carazolol |
Sigma |
Cat#53787 |
| Epinephrine |
Sigma |
Cat#E4642 |
| Dopamine hydrochloride |
Sigma |
Cat#H8502 |
| Sodium bisulfite |
Thermo Fisher Scientific |
At# S-244 |
| Cmpd-6FA |
Ahn S, et. al., 2018
|
N/A |
| Isoproterenol hydrochloride |
Tocris Bioscience |
Cat#1747 |
| Fab30 |
Shukla AK et. al., 2013 |
N/A |
| Nb6B9 |
Liu, et. al., 2019
|
N/A |
| NeutrAvidin |
Thermo Fisher Scientific |
Cat#31000 |
| Bovine Serum Albumin |
VWR |
Cat#EM-2930 |
| Glucose oxidase |
Sigma |
Cat#G2133 |
| Catalase |
Sigma |
Cat#C40 |
| pβ2V2R |
Kahsai, et. al., 2016; Shukla, et. al., 2014b
|
N/A |
| bpβ2V2R |
Kahsai, et. al., 2016; Shukla, et. al., 2014b
|
N/A |
| Strep-β-arrestin1 E176C, K397C (βarr1 tail sensor) |
This paper |
N/A |
| Strep-β-arrestin1 E110C, K397C |
This paper |
N/A |
| Strep-β-arrestin1 E176C, K397C; 3-EI mutations: I386A, V387A, F388A (3EI-βarr1 tail sensor) |
This paper |
N/A |
| Strep-β-arrestin1 E176C, K397C; E313K finger loop proximal mutation (313K-βarr1 tail sensor) |
This paper |
N/A |
| Strep-β-arrestin1 E176C, K397C; finger loop proximal mutations: R76A, K77A, D78A |
This paper |
N/A |
| Strep-β-arrestin1 E176C |
This paper |
N/A |
| Strep-β-arrestin1 K397C |
This paper |
N/A |
| Wildtype β-arrestin 1 |
Nobles KN et. al., 2007
|
N/A |
| Lipofectamine 2000 |
Thermo Fisher Scientific |
Cat#11668019 |
| linear polyethyleneimine MAX (MW 40,000) |
Polysciences |
Cat#24761-1 |
| Coelenterazine h |
Dalton Pharma Services |
Cat#20-0770 |
| Nano-Glo Substrate |
Promega |
Cat# N113A |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Critical commercial assays
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Deposited data
|
| Active-state crystal structure of β-arrestin 1 bound to the phosphorylated V2R C-tail phosphopeptide and Fab30 |
Shukla et al., 2013a
|
PDB: 4JQI |
| Inactive-state crystal structure of β-arrestin 1 |
Han et al., 2001
|
PDB: 1G4M |
| Inactive-state crystal structure of β-arrestin 1 |
Milano et al., 2002
|
PDB: 1JSY |
| Crystal structure of bovine arrestin-2 in complex with inositol hexakisphosphate (IP6) |
Milano et al., 2006a
|
PDB: 1ZSH |
| Inactive-state crystal structure of visual arrestin |
Hirsch et al., 1999
|
PDB: 1CF1 |
| Inactive-state crystal structure of bovine rhodopsin |
Palczewski et al., 2000
|
PDB: 1F88 |
| Inactive-state crystal structure of bovine rhodopsin |
Teller et al., 2001
|
PDB: 1HZX |
| Crystal structure of 9-cis-rhodopsin |
Nakamichi et al., 2007
|
PDB: 2PED |
| Structure of β2 adrenoceptor bound to adrenaline and an engineered nanobody |
Ring et al., 2013
|
PDB: 4LDO |
| Crystal structure of the β2 adrenergic receptor-Gs protein complex |
Rasmussen et al., 2011
|
PDB: 3SN6 |
| Cryo-EM structure of β-arrestin 1 bound to M2 muscarinic acetylcholine receptor containing the V2R C-tail (M2V2R) |
Staus et al., 2020a
|
PDB: 6U1N |
| Phosphorylated turkey β1 adrenoceptor with bound agonist formoterol coupled to arrestin-2 in lipid nanodisc |
Lee et al., 2020
|
PDB: 6TKO |
| Stabilized β-arrestin 1-V2T subcomplex of a GPCR-G protein-β-arrestin mega-complex |
Nguyen et al., 2019
|
PDB: 6NI2 |
| GRK1-rhodopsin complex |
Chen et al., 2021b
|
PDB: 7MTA |
|
|
|
|
|
|
|
|
|
|
Experimental models: Cell lines
|
| Human: Passage 4-15 HEK293A GRK2/3/5/6 knockout cells |
Kawakami et. al., 2022
|
N/A |
| Sf9 Insect cells |
Expression Systems |
Cat#94-001F |
|
|
|
|
|
|
|
|
|
|
Experimental models: Organisms/strains
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Oligonucleotides
|
| 25-nucleotide DNA duplex as blocking agent sequence: GTGCTTGGGACCCCACGTGTAAACG |
IDT |
N/A |
|
|
|
|
|
|
|
|
|
|
|
|
|
Recombinant DNA
|
| pTrcHisB Cysless β-arrestin1 |
Hanson et. al., 2007
|
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E176C, K397C (βarr1 tail sensor) |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E110C, K397C |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E176C, K397C; 3-EI mutations: I386A, V387A, F388A (3EI-βarr1 tail sensor) |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E176C, K397C; E313K finger loop proximal mutation (313K-βarr1 tail sensor) |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E176C, K397C; finger loop proximal mutations: R76A, K77A, D78A |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 E176C |
This paper |
N/A |
| pTrcHisB Cysless Strep-β-arrestin1 K397C |
This paper |
N/A |
| Plasmid: wildtype β-arrestin 1 |
Nobles KN et. al., 2007
|
N/A |
| Plasmid: GRK2-CAAX |
Kahsai et. al., 2016; Shukla et. al., 2014b
|
N/A |
| pcDNA3.1 SNAPf-β2AR |
This paper |
N/A |
| pcDNA3.1 SNAPf-β2AR-365tr |
This paper |
N/A |
| pcDNA3.1 FLAG-D2L |
Donthamsetti et. al., 2015
|
N/A |
| pcDNA3.1 mem-citrine |
Donthamsetti et. al., 2015
|
N/A |
| pcDNA3.1 Rluc8-β-arrestin2 |
Donthamsetti et. al., 2015
|
N/A |
| Plasmid: GRK2 |
Donthamsetti et. al., 2015
|
N/A |
| pcDNA5 FRT |
Invitrogen |
Cat#601020 |
| pcDNA3.1(+) |
Thermo fisher Scientific |
Cat#V79020 |
| Plasmid: NES-NanoLuc-mGs |
Wan et. al., 2018
|
N/A |
| Plasmid: Venus-kras |
Lan et. al., 2011
|
N/A |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Software and algorithms
|
|
|
| LabVIEW |
National Instruments |
https://www.ni.com/
|
| SPARTAN |
Juette et. al., 2016
|
https://www.scottcblanchardlab.com/spartan-download
|
| MATLAB 2018a |
Mathworks |
https://www.mathworks.com/
|
| Fretica (WSTP for Wolfram Mathematica) |
Wolfram Research |
https://schuler.bioc.uzh.ch/programs
|
| Confocal data acquisition - SymPhoTime 64 V2.5 |
Picoquant |
https://www.picoquant.com/products/category/software/symphotime-64-fluorescence-lifetime-imaging-and-correlation-software
|
| MicroCal PEAQ-ITC analysis software |
Malvern |
https://www.malvernpanalytical.com
|
| Modeller v10.0 |
Eswar et. al., 2006
|
https://salilab.org/modeller/
|
| ROSETTA v2019.47.61047 |
Stein et. al., 2013
|
https://www.rosettacommons.org/software
|
| Schrodinger Suite v2021-1 |
Schrodinger |
https://www.schrodinger.com/
|
| Desmond MD System v6.1 |
D.E. Shaw Research |
https://www.deshawresearch.com/resources_desmond.html
|
| VMD v1.9.3 |
Humphrey et. al., 1996
|
https://www.ks.uiuc.edu/Research/vmd/
|
| PyMol v1.4.1 |
Schrödinger |
https://pymol.org/
|
| Avogadro v1.2.0 |
Hanwell, et. al., 2012
|
http://avogadro.openmolecules.net/
|
| SMOG v2.2 |
Noel, 2016
|
https://smog-server.org/smog2/
|
| GROMACS v2019 |
Hess et. al., 2008
|
https://www.gromacs.org/
|
| OriginPro v2020b |
OriginLab |
https://www.originlab.com/
|
| GraphPad Prism v9.3.1 |
GraphPad Software, LLC |
https://www.graphpad.com/
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Other
|
|
|
| Microfluidic imaging chambers for TIRF-based smFRET |
Blanchard et. al., 2004
|
N/A |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
