. 2022 Jun 13;9(2):118–123. doi: 10.1055/s-0041-1740019

Table 1. Primer sequences used for multiplex polymerase chain reaction amplification of bla _OXA genes variants .

Primer name		5′ to 3′ sequence prime	Product size (bp)	Annealing temperature (°C)	Reference
OXA-51-like	F	TAATGCTTTGATCGGCCTTG	353	53	Woodford (2006) 18
OXA-51-like	R	TGGATTGCACTTCATCTTGG	353	53	Woodford (2006) 18
OXA-23-like	F	GATCGGATTGGAGAACCAGA	501	53	Woodford (2006) 18
OXA-23-like	R	ATTTCTGACCGCATTTCCAT	501	53	Woodford (2006) 18
OXA-24-like	F	GGTTAGTTGGCCCCCTTAAA	246	53	Woodford (2006) 18
OXA-24-like	R	AGTTGAGCGAAAAGGGGATT	246	53	Woodford (2006) 18
OXA-58-like	F	AAGTATTGGGGCTTGTGCTG	599	53	Woodford (2006) 18
OXA-58-like	R	CCCCTCTGCGCTCTACATAC	599	53	Woodford (2006) 18

Table 1. Primer sequences used for multiplex polymerase chain reaction amplification of bla OXA genes variants .