TABLE 2.

Characteristics of oligonucleotide probes used to distinguish Hyphomicrobium spp.

Target bacteria or probe	Oligonucleotide probe		16S rRNA location	No. of probe mismatches to 16S rDNA sequences from control strains and clones of:
	Designation	Sequence		Cluster I	Cluster II	Z. ramigera	Bradyrhizobium japonicum
Hyphomicrobium genus	S-G-Hypho-1241-a-A-19	GCTGC(G/C)CATTGTCACCGCC	1241–1260	0	0	2	2
Hyphomicrobium cluster Ia	S-S-HyphoC1-648-a-A-20	CCTCTTCCGGACTCGAGACT	648–667	0–1c	2–3	4	5
Hyphomicrobium cluster IIb	S-S-HyphoCII-654-a-A-18	CCCACCTCTATCGGACTC	654–672	2–5	0	6	4
Universal probe 1390	S-*-Univ-1390-a-A-18d	GACGGGCGGTGTGTAAA	1390–1408	0	0	0	0

^aCluster I strains: H. vulgare ATCC 25700 (Y14302), Hyphomicrobium-like sp. strain US-353 (U06473), Hyphomicrobium hollandicum IFAM KB-677 (Y14303), Hyphomicrobium aestuarii DSM 1564 (Y14304); cluster I clones: 1951, 1956, 49519, 49520. 

^bCluster II strains: Hyphomicrobium sp. strain M3, H. denitrificans DSM 1869 (Y14308), Hyphomicrobium methylovorum DSM 5458 (Y14307), Hyphomicrobium facilis sp. strain H-526 (Y14309), Hyphomicrobium facilis ATCC 27492 (Y14310); cluster II clones: 4953, 49512, 49518. 

^cThe cluster I probe has one mismatch in the last 3′ base to clones 49519 and 49520. 

^dSee reference 38.