TABLE 2.
Target bacteria or probe | Oligonucleotide probe
|
16S rRNA location | No. of probe mismatches to 16S rDNA sequences from control strains and clones of:
|
||||
---|---|---|---|---|---|---|---|
Designation | Sequence | Cluster I | Cluster II | Z. ramigera | Bradyrhizobium japonicum | ||
Hyphomicrobium genus | S-G-Hypho-1241-a-A-19 | GCTGC(G/C)CATTGTCACCGCC | 1241–1260 | 0 | 0 | 2 | 2 |
Hyphomicrobium cluster Ia | S-S-HyphoC1-648-a-A-20 | CCTCTTCCGGACTCGAGACT | 648–667 | 0–1c | 2–3 | 4 | 5 |
Hyphomicrobium cluster IIb | S-S-HyphoCII-654-a-A-18 | CCCACCTCTATCGGACTC | 654–672 | 2–5 | 0 | 6 | 4 |
Universal probe 1390 | S-*-Univ-1390-a-A-18d | GACGGGCGGTGTGTAAA | 1390–1408 | 0 | 0 | 0 | 0 |
Cluster I strains: H. vulgare ATCC 25700 (Y14302), Hyphomicrobium-like sp. strain US-353 (U06473), Hyphomicrobium hollandicum IFAM KB-677 (Y14303), Hyphomicrobium aestuarii DSM 1564 (Y14304); cluster I clones: 1951, 1956, 49519, 49520.
Cluster II strains: Hyphomicrobium sp. strain M3, H. denitrificans DSM 1869 (Y14308), Hyphomicrobium methylovorum DSM 5458 (Y14307), Hyphomicrobium facilis sp. strain H-526 (Y14309), Hyphomicrobium facilis ATCC 27492 (Y14310); cluster II clones: 4953, 49512, 49518.
The cluster I probe has one mismatch in the last 3′ base to clones 49519 and 49520.
See reference 38.