Table 2.
ASO-PCR for the tyrosine kinase domain mutations tested
Primer sequence | |||||||
---|---|---|---|---|---|---|---|
| |||||||
Type | Forward primer sequence 5’to 3’ | Reverse primer sequence 5’to 3’ | |||||
T315I | GCC CCC GTT CTA TAT CAT CAT [mutant forward (MF)] | GGA TGA AGT TTT TCT TCT CCA G [mutant reverse (MR)] | |||||
G250E | GAA GCA CAA GCT GGG CGA [mutant forward (MF)] | GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)] | |||||
E255K | GCG GGG GCC AGT ACG GGA [mutant forward (MF)] | GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)] | |||||
M244V | GAA CGC ACG GAC ATC ACC G [mutant forward (MF)] | GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)] | |||||
M351T | CCACTCAGATCTCGTCAGCCAC [mutant forward (MF)] | ATG CCC AAA GCT GGC TTT G [mutant reverse (MR)] | |||||
Y253F | CTG GGC GGG GGC CAG TT [mutant forward (MF)] | GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)] | |||||
Wild Type | TGG TTC ATC ATC ATT CAA CGG TGG [Wild type forward (WF)] | GTT CCC GTA GGT CAT GAA CTC AG [Wild type reverse (WR)] | |||||
The last nucleotide of the forward primers of each specific mutation is mutated | |||||||
| |||||||
PCR reagents | |||||||
| |||||||
Reagents | Mutation tested | ||||||
| |||||||
E255K | Y253F | T315I | M244V | G250E | M351T | ||
| |||||||
Distilled water (µL) | 19.0 | 19.2 | 15.4 | 14.5 | 19.2 | 14.5 | |
Buffer (µL) | 2.5 | 2.5 | 2.0 | 2.0 | 2.5 | 2.0* | |
dNTP (µL) | 0.4 | 0.5 | 0.4 | 0.5 | 0.5 | 0.5 | |
MgCl2 (µL) | 0.1 | - | - | - | - | 0.2 | |
Primers used | MF and MR | MF, WF WR | MF and MR | MF and WR | MF, WF and WR | MF and MR | |
Primer volume (µL) | 0.3 | 0.3 | 0.5 | 0.5 | 0.3 | 0.5 | |
Taq Polymerase (µL) | 0.4 | 0.4 | 0.3 | 0.5 | 0.4 | 0.5 | |
Annealing temperature (°C) | 66 | 55 | 66 | 71.5 | 56 | 72 | |
Product length (bp) | Wild KD | - | 374 | - | - | 374 | - |
Mutant KD | 194 | 226 | 158 | 227 | 255 | 236 | |
| |||||||
* MgCl2 depleted buffer was used. MF: Mutant forward; MR: Mutant reverse; WF: Wild type forward; WR: Wild type reverse. | |||||||
PCR CONDITIONS | |||||||
| |||||||
Pre-heating | 94°C for 5 minutes | ||||||
Amplification x 30 cycles | Denaturation - 94°C for 25 seconds Annealing- At respective temperatures indicated above, for 25 seconds Extension- 72°C for 30 seconds. |
||||||
Final extension | 72°C for 5 minutes |