Table 2.

ASO-PCR for the tyrosine kinase domain mutations tested

Primer sequence
Type	Forward primer sequence 5’to 3’			Reverse primer sequence 5’to 3’
T315I	GCC CCC GTT CTA TAT CAT CAT [mutant forward (MF)]			GGA TGA AGT TTT TCT TCT CCA G [mutant reverse (MR)]
G250E	GAA GCA CAA GCT GGG CGA [mutant forward (MF)]			GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)]
E255K	GCG GGG GCC AGT ACG GGA [mutant forward (MF)]			GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)]
M244V	GAA CGC ACG GAC ATC ACC G [mutant forward (MF)]			GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)]
M351T	CCACTCAGATCTCGTCAGCCAC [mutant forward (MF)]			ATG CCC AAA GCT GGC TTT G [mutant reverse (MR)]
Y253F	CTG GGC GGG GGC CAG TT [mutant forward (MF)]			GCC AAT GAA GCC CTC GGA C [mutant reverse (MR)]
Wild Type	TGG TTC ATC ATC ATT CAA CGG TGG [Wild type forward (WF)]			GTT CCC GTA GGT CAT GAA CTC AG [Wild type reverse (WR)]
The last nucleotide of the forward primers of each specific mutation is mutated
PCR reagents
Reagents		Mutation tested
		E255K	Y253F	T315I	M244V	G250E	M351T
Distilled water (µL)		19.0	19.2	15.4	14.5	19.2	14.5
Buffer (µL)		2.5	2.5	2.0	2.0	2.5	2.0*
dNTP (µL)		0.4	0.5	0.4	0.5	0.5	0.5
MgCl2 (µL)		0.1	-	-	-	-	0.2
Primers used		MF and MR	MF, WF WR	MF and MR	MF and WR	MF, WF and WR	MF and MR
Primer volume (µL)		0.3	0.3	0.5	0.5	0.3	0.5
Taq Polymerase (µL)		0.4	0.4	0.3	0.5	0.4	0.5
Annealing temperature (°C)		66	55	66	71.5	56	72
Product length (bp)	Wild KD	-	374	-	-	374	-
	Mutant KD	194	226	158	227	255	236
* MgCl2 depleted buffer was used. MF: Mutant forward; MR: Mutant reverse; WF: Wild type forward; WR: Wild type reverse.
PCR CONDITIONS
Pre-heating		94°C for 5 minutes
Amplification x 30 cycles		Denaturation - 94°C for 25 seconds Annealing- At respective temperatures indicated above, for 25 seconds Extension- 72°C for 30 seconds.
Final extension		72°C for 5 minutes