| Antibodies |
|
| Rabbit polyclonal anti-GFP |
Invitrogen |
Cat# A11122; RRID: AB_221569
|
| Mouse monoclonal anti-Sox2 |
Abcam |
Cat# ab79351; RRID: AB_10710406
|
| Goat anti-Rabbit IgY (H+L) CF®488 |
Biotium |
Cat# 20012; RRID: AB_10559670
|
| Goat anti-Mouse IgY (H+L) CF®568 |
Biotium |
Cat# 20101; RRID: AB_10559187
|
|
| Bacterial and virus strains |
|
| Escherichia coli (E. coli) DH5α competent cells |
TransGen Biotech |
Cat# CD201-01 |
|
| Chemicals, peptides, and recombinant proteins |
|
| Sodium pentobarbital |
Sigma-Aldrich |
Cat# 52944-66-8 |
| Sucrose |
Sigma-Aldrich |
Cat# 57-50-1 |
| Mounting medium |
Invitrogen |
Cat# P36961
|
| Proteinase K |
cwbiotech |
Cat# CW2584M |
| PCR 2× Mix buffer |
cwbiotech |
Cat# CW0690L |
| PBS |
ZSGB-BIO |
Cat# ZLI-9061 |
| Depilatory cream |
Veet |
N/A |
| Bovine serum albumin (BSA) |
Sigma-Aldrich |
Cat# 1933 |
| Normal goat serum (NGS) |
ZSGB-BIO |
Cat# ZLI-9021 |
| Paraformaldehyde |
Solarbio |
Cat# P1110 |
| O.C.T. Compound |
SAKURA |
Cat# 4583 |
| Saline |
Solarbio |
Cat# IN9000 |
| 2×YT medium |
Sigma-Aldrich |
Cat# Y2377 |
| Fast Green |
Sigma-Aldrich |
Cat# F7252 |
| Triton X-100 |
Sigma-Aldrich |
Cat# X100 |
|
| Critical commercial assays |
|
| Senescence-associated β-galactosidase staining kit |
Beyotime |
Cat# C0602 |
| EndoFree Maxi Plasmid Kit V2 |
TIANGEN |
Cat# DP120 |
|
| Experimental models: Organisms/strains |
|
| Mouse: Rack1F/F (C57BL/6, E14.5 and E18.5) |
(Zhao et al., 2015) |
N/A |
|
| Oligonucleotides |
|
| Primer used for genotyping: Rack1 loxP-F: |
This paper |
CGCTGCGCCTCTGGGATCTCA |
| Primer used for genotyping: Rack1 loxP-R: |
This paper |
TGGTGTGGCCGACAAATCGCC |
|
| Recombinant DNA |
|
| pCAG-dCre-GFP |
A gift from Dr. Weixiang Guo, Institute of Genetics and Developmental Biology, CAS |
N/A |
| pCAG-Cre-GFP |
A gift from Dr. Weixiang Guo, Institute of Genetics and Developmental Biology, CAS |
N/A |
|
| Software and algorithms |
|
| Image J |
(Schneider et al., 2012) |
https://imagej.nih.gov/ij/ |
| NDP 2.0 view |
Hamamatsu |
https://www.hamamatsu.com/jp/en/product/type/U12388-01/index.html |
| GraphPad Prism8 |
Prism |
https://www.graphpad.com/scientific-software/prism/ |
| Olympus FV-1200 |
Olympus |
https://www.olympus-lifescience.com.cn/es/support/downloads/ |
| Olympus Fluoview Ver.4.2b View |
Olympus |
https://www.olympus-lifescience.com/es/support/downloads/#!dlOpen=%23detail847249651 |
| Adobe Photoshop CC |
Adobe |
https://www.adobe.com/products/photoshop.html |
|
| Other |
|
| Electro Square PoratorTM |
BTX |
ECM 830 |
| Confocal Laser Scanning Microscope |
Olympus |
FV1200 |
| NanoZoomer Digital Pathology |
Hamamatsu |
NanoZoomer2.0 |
| Cryomold |
Thermo Fisher Scientific |
CRYOSTAR NX50 |
| Incubator |
Thermo Fisher Scientific |
IMC18 |