TABLE 1.
Primera | Sequence (5′-3′) | Target | Reference |
---|---|---|---|
Bac32F | AACGCTAGCTACAGGCTT | Bacteroides-Prevotella | This study |
Bac303R | CCAATGTGGGGGACCTTC | Bacteroides-Prevotella | —b |
Bac708R | CAATCGGAGTTCTTCGTG | Bacteroides-Prevotella | This study |
Bif164F | GGGTGGTAATGCCGGATG | Bifidobacterium | 36 |
Bif601R | TAAGCGATGGACTTTCACACC | Bifidobacterium | This study |
Bac, Bacteroides-Prevotella; Bif, Bifidobacterium. The numbers correspond to numbers in the E. coli 16S rRNA gene.
Modified from the study of Manz et al. (40).