KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER | 
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-ROS1 (phospho-Y2274) | Thermo Fisher Scientific | Cat#PA5-64608; RRID:AB_2663812 | 
| Mouse monoclonal anti-ROS1 | Origene | Cat#TA805734; RRID:AB_2627841 | 
| Mouse polyclonal anti-ZCCHC8 | Abcam | Cat#ab68739; RRID:AB_1271512 | 
| Mouse monoclonal anti-GFP | Thermo Fisher Scientific | Cat#MA5-15256; RRID:AB_10979281 | 
| Mouse monoclonal Anti-mCherry | Thermo Fisher Scientific | Cat#MA5-32977 | 
| Mouse monoclonal anti-beta-actin | Thermo Fisher Scientific | Cat#MA5-15739; RRID:AB_10979409 | 
| Sheep monoclonal anti-mouse IgG | GE Healthcare | Cat#NA931V; RRID:AB_772210 | 
| Bacterial and virus strains | ||
| E. coli BL21CodonPlus(DE3)-RIL competent cells | Agilent Technologies | Cat#230245 | 
| E. coli E. cloni 10G competent cells | Lucigen | Cat#60106-2 | 
| Chemicals, peptides, and recombinant proteins | ||
| AdvanBlock-Chemi blocking solution | Advansta | Cat#R-03726-E10 | 
| Adenosine 5′(β,γ-imido) triphosphate lithium salt hydrate | Sigma | Cat#A2647 | 
| GFP-Trap magnetic agarose | Chromotek | Cat#gtma-20; RRID:AB_2631358 | 
| IGEPAL CA-630 | Sigma | Cat#I8896 | 
| Iscove’s Modified Dulbecco’s medium | Thermo Fisher Scientific | Cat#12440053 | 
| Laemmli Sample buffer (4X) | Bio-Rad | Cat#1610747 | 
| Magnesium chloride hexahydrate | Sigma | Cat#M9272 | 
| Tris(2-carboxyethyl)phosphine (TCEP) | Soltec Ventures | Cat#M115 | 
| RIPA | Thermo Fisher Scientific | Cat#89901 | 
| RNase inhibitor, human placenta | New Engaland Biolabs | Cat#M0307S | 
| Proteinase K | New England Biolabs | Cat#P8107S | 
| Superdex 200 Increase 10/300 GL | GE Healthcare | Cat#28990944 | 
| SuperSep Phos-tag (50 μmol/L), 12.5%, 17-well | FUJIFILM Wako | Cat#195-17991 | 
| SuperSignal West Dura Extended Duration substrate | Thermo Fisher Scientific | Cat#34075 | 
| TBE (10X) | Thermo Fisher Scientific | Cat#AM9864 | 
| NU7741 | StemCell Technologies | Cat#74082 | 
| NuPAGE MES SDS Running Buffer (20X) | Thermo Fisher Scientific | Cat#NP0002 | 
| NuPAGE LDS Sample Buffer (4X) | Thermo Fisher Scientific | Cat#NP0007 | 
| Novex TBE gel, 20% | Thermo Fisher Scientific | Cat#EC63152BOX | 
| Novex TBE gel, 4-40% | Thermo Fisher Scientific | Cat#EC62252BOX | 
| NuPage 4-12% Bis-Tris protein gels | Thermo Fisher Scientific | Cat#NP0322BOX | 
| NuPage Transfer Buffer (20X) | Thermo Fisher Scientific | Cat#NP006 | 
| Ni-NTA agarose | Qiagen | Cat#30250 | 
| HiTrap Heparin HP | GE Healthcare | Cat#17040601 | 
| HiLoad 26/600 Superdex 200 pg | GE Healthcare | Cat#289289336 | 
| Ulp1 protease | In-house | N/A | 
| Critical commercial assays | ||
| Expi293 Expression System Kit | Thermo Fisher Scientific | Cat#A14635 | 
| Gel filtration calibration kit high molecular weight | GE Healthcare | Cat#28403842 | 
| iBind Flex solution kit | Thermo Fisher Scientific | Cat#SLF2020 | 
| Lipofectamine 3000 transfection reagents | Thermo Fisher Scientific | Cat#L3000001 | 
| LIVE/DEAD Fixable Violet Dead Cell Stain Kit | Thermo Fisher Scientific | Cat#L34955 | 
| NucSpot Live 650 kit | Biotium | Cat#40082 | 
| RNeasy Pus Mini Kit | Qiagen | Cat#74034 | 
| Superscript IV VILO master mix | Thermo Fisher Scientific | Cat#11756050 | 
| TruSeq Standard Total RNA LT Kit | Illumina | Cat#RS-122-1202 | 
| WesternEaze-Chemi kit | Advansta | Cat#K-12054-010 | 
| Zip Alexa Fluor 647 Rapid Antibody Labeling Kit | Thermo Fisher Scientific | Cat#Z11235 | 
| Deposited data | ||
| NEXT-RNA substrate 1 complex structure | This paper | PDB: 7S7B | 
| NEXT-RNA substrate 1 complex EM maps | This paper | EMDB: EMD-24882 | 
| NEXT-RNA substrate 2 complex structure | This paper | PDB: 7S7C | 
| NEXT-RNA substrate 2 complex EM maps | This paper | EMDB: EMD-24883 | 
| Apo NEXT EM map | This paper | EMDB: EMD-24884 | 
| RNA-seq data | This paper | GEO: GSE185374 Token: ytspiamilduxlsx | 
| Experimental models: Cell lines | ||
| Human: Expi293F cells | Thermo Fisher Scientific | Cat#A14635 | 
| Human: HAP1 | Horizon Discovery | Cat#C631 | 
| Human: HAP1 ZCCHC8 knockout | Horizon Discovery | Cat#HZGHC005158c012 | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC8, and PB-mCherry-ZCCHC8 | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC8ΔHD, and PB-mCherry-ZCCHC8 | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC81-80-ROS1kinase, and PB-mCherry-ZCCHC81-80-ROS1kinase | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC81-80dm-ROS1kinase, and PB-mCherry-ZCCHC81-80-ROS1kinase | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ROS1kinase, and PB-mCherry-ROS1kinase | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP- ZCCHC81-80-ROS1kinase, and PB-mCherry-ZCCHC8 | This work | N/A | 
| Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP- ROS1kinase, and PB-mCherry-ZCCHC8 | This work | N/A | 
| Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8 | This work | N/A | 
| Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8ΔHD | This work | N/A | 
| Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8ΔZK | This work | N/A | 
| Human: HAP1 ZCCHC8 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80-ROS1kinase | This work | N/A | 
| Human: HAP1 ZCCHC8 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80dm-ROS1kinase | This wok | N/A | 
| Human: HAP1 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80-ROS1kinase(dead) | This work | N/A | 
| Human: HAP1 stably transfected with PB-rtTA-Puro and PB-GFP-ROS1kinase | This work | N/A | 
| Oligonucleotides | ||
| 6-FAM-AGCACCGUAAAGACGC (gel-based assay RNA top strand) | IDT | N/A | 
| GCGUCUUUACGGUGCUAAAAAAAAAAAAAAAAAAAA (gel-based assay bottom strand for duplex with 3′ 20-nt poly(A) overhang) | IDT | N/A | 
| GCGUCUUUACGGUGCUUpyAAAAAAAAAAAAAAAAA (gel-based assay bottom strand for duplex with 2′ pyrene modified uridine Upy) | Dharmacon | N/A | 
| ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAAUpyACAAAAAAAA (cryo-EM substrate 1, Upy= 2′ pyrene modified uridine) | Dharmacon | N/A | 
| GGCGCGCGCCAAAAAUUUUUAAAAAAAAAA (cryo-EM substrate 2) | Dharmacon | N/A | 
| 6-FAM-AGUGCGCUGUAUCUUCAAGGCCACU (EMSA RNA top strand) | IDT | N/A | 
| Iowa Black RQ-AGUGCGCUGUAUCUUCAAGGCCACU-Cy5 (molecular beacon helicase assay RNA top strand) | IDT | N/A | 
| AGUGGCCUUGAAGAUACAGCGCACUAAAAAAAAAAAAAAAAAAAA (molecular beacon assay RNA bottom strand with 3′ 20-nt poly(A) overhang) | IDT | N/A | 
| AGUGGCCUUGAAGAUACAGCGCACUAAAAAUUUUUAAAAAAAAAA (molecular beacon assay RNA bottom strand with 3′ A5U5A10 overhang) | IDT | N/A | 
| qPCR and CRISPR screening primers | See Table S2 | N/A | 
| Recombinant DNA | ||
| pET-28a-His10-Smt3-RBM7core | Puno and Lima, 2018 | N/A | 
| pET-28a- His10-Smt3-MTR4 | Puno and Lima, 2018 | N/A | 
| pRSF-Duet1-Smt3-ZCCHC8core | Puno and Lima, 2018 | N/A | 
| pRSF-Duet1-Smt3-ZCCHC8coreΔHD | This work | N/A | 
| pRSF-Duet1-Smt3-ZCCHC8coreΔZK | This work | N/A | 
| pRSF-HiS6-ncSmt3-MTR4 | This work | N/A | 
| pET-28a- His10-Smt3-Strep-MTR4 | This work | N/A | 
| pET-28a- His10-Smt3-Strep-MTR4-E253Q | This work | N/A | 
| pRP[Exp]-mCherry-CAG>hyPBase | VectorBuilder | Cat#VB160216-10057 | 
| PB-TAG-ERPE | Addgene; Kim et al., 2015 | Cat#80479, RRID:Addgene_80479 | 
| PB-rtTA-Puro | This work | N/A | 
| PB-GFP-ZCCHC8 | This work | N/A | 
| PB-GFP-ZCCHC8ΔNTD | This work | N/A | 
| PB-mCherry-ZCCHC8 | This work | N/A | 
| PB-GFP-ZCCHC8ΔZK | This work | N/A | 
| PB-GFP-ZCCHC81-80-ROS1kinase | This work | N/A | 
| PB-GFP-ZCCHC81-80-ROS1kinase(dead) | This work | N/A | 
| PB-GFP-ZCCHC81-80dm-ROS1kinase | This work | N/A | 
| PB-GFP-ROS1kinase | This work | N/A | 
| pRP[2CRISPR]-mCherry-hCas9-U6>{hZCCHC8[gRNA#1]}-U6>{hZCCHC8[gRNA#2]}) | This work | Cat#: VB200528-1045ndr | 
| Software and algorithms | ||
| BD FACSDiva software | BD Biosciences | http://www.bdbiosciences.com/instruments/software/facsdiva/index.jsp; RRID:SCR_001456 | 
| Biorender | Biorender | http://biorender.com; #NI22WEQFBQ;#YI22XZN09U and #TM22XZN108 RRID:SCR_018361 | 
| Coot | Emsley et al., 2010 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/; RRID:SCR_014222 | 
| FCS Express Research version 7 | De Novo software company | https://denovosoftware.com/; RRID:SCR_016431 | 
| Gctf | Zhang, 2016 | https://www2.mrc-lmb.cam.ac.uk/research/locally-developed-software/zhang-software/#gctf; RRID:SCR_016500 | 
| Integrative Genomics Viewer (IGV) | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/ | 
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ | 
| Jalview version 2 | Waterhouse et al., 2009 | www.jalview.org/: RRID:SCR_006459 | 
| Leginon data collection software | Suloway et al., 2005 | https://emg.nysbc.org/redmine/projects/leginon; RRID:SCR_016731 | 
| MolProbity | Chen et al., 2010 | http://molprobity.biochem.duke.edu; RRID:SCR_014226 | 
| Phenix suite | Adams et al., 2010 | https://www.phenix-online.org/; RRID:SCR_014224 | 
| Prism version 9 | Graphpad | https://www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 | 
| Pymol version 2.4.1 | Schroedinger LLC | https://pymol.org; RRID:SCR_000305 | 
| RELION | Scheres, 2012; Zivanov et al., 2018 | http://www2.mrc-lmb.cam.ac.uk/relion; RRID:SCR_016274 | 
| Serial EM data collection software | Mastronarde, 2003 | http://bio3d.colorado.edu/SerialEM/; RRID:SCR_017293 | 
| STAR | Dobin et al., 2013 | http://code.google.com/p/rna-star/; RRID:SCR_004463 | 
| UCSF ChimeraX version 1.2.5 | Pettersen et al., 2021 | https://www.cgl.ucsf.edu/chimerax/; RRID:SCR_015872 | 
| UCSF MotionCor2 | Zheng et al., 2017 | https://emcore.ucsf.edu/ucsf-software | 
| Other | ||
| Quantifoil R 1.2/1.3 300 mesh gold grids | Electron Microscopy Services | Cat#Q43841 | 
| Vitrobot Mark IV | FEI – Thermo Fisher | https://www.fei.com | 
| Titan Krios | FEI – Thermo Fisher | https://www.fei.com | 
| K2 Summit Camera | Gatan, Inc | www.gatan.com | 
| K3 Camera | Gatan, Inc | www.gatan.com | 
| Corning 3693 White Half-Area 96-well plate | Fisher Scientific | Cat#07-200-326 | 
| Trans-blot Turbo | Bio-Rad | Cat#1704150 | 
| iBind Flex Western device | Thermo Fisher Scientific | Cat#SLF2000 |