KEY RESOURCES TABLE
REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Rabbit polyclonal anti-ROS1 (phospho-Y2274) | Thermo Fisher Scientific | Cat#PA5-64608; RRID:AB_2663812 |
Mouse monoclonal anti-ROS1 | Origene | Cat#TA805734; RRID:AB_2627841 |
Mouse polyclonal anti-ZCCHC8 | Abcam | Cat#ab68739; RRID:AB_1271512 |
Mouse monoclonal anti-GFP | Thermo Fisher Scientific | Cat#MA5-15256; RRID:AB_10979281 |
Mouse monoclonal Anti-mCherry | Thermo Fisher Scientific | Cat#MA5-32977 |
Mouse monoclonal anti-beta-actin | Thermo Fisher Scientific | Cat#MA5-15739; RRID:AB_10979409 |
Sheep monoclonal anti-mouse IgG | GE Healthcare | Cat#NA931V; RRID:AB_772210 |
Bacterial and virus strains | ||
E. coli BL21CodonPlus(DE3)-RIL competent cells | Agilent Technologies | Cat#230245 |
E. coli E. cloni 10G competent cells | Lucigen | Cat#60106-2 |
Chemicals, peptides, and recombinant proteins | ||
AdvanBlock-Chemi blocking solution | Advansta | Cat#R-03726-E10 |
Adenosine 5′(β,γ-imido) triphosphate lithium salt hydrate | Sigma | Cat#A2647 |
GFP-Trap magnetic agarose | Chromotek | Cat#gtma-20; RRID:AB_2631358 |
IGEPAL CA-630 | Sigma | Cat#I8896 |
Iscove’s Modified Dulbecco’s medium | Thermo Fisher Scientific | Cat#12440053 |
Laemmli Sample buffer (4X) | Bio-Rad | Cat#1610747 |
Magnesium chloride hexahydrate | Sigma | Cat#M9272 |
Tris(2-carboxyethyl)phosphine (TCEP) | Soltec Ventures | Cat#M115 |
RIPA | Thermo Fisher Scientific | Cat#89901 |
RNase inhibitor, human placenta | New Engaland Biolabs | Cat#M0307S |
Proteinase K | New England Biolabs | Cat#P8107S |
Superdex 200 Increase 10/300 GL | GE Healthcare | Cat#28990944 |
SuperSep Phos-tag (50 μmol/L), 12.5%, 17-well | FUJIFILM Wako | Cat#195-17991 |
SuperSignal West Dura Extended Duration substrate | Thermo Fisher Scientific | Cat#34075 |
TBE (10X) | Thermo Fisher Scientific | Cat#AM9864 |
NU7741 | StemCell Technologies | Cat#74082 |
NuPAGE MES SDS Running Buffer (20X) | Thermo Fisher Scientific | Cat#NP0002 |
NuPAGE LDS Sample Buffer (4X) | Thermo Fisher Scientific | Cat#NP0007 |
Novex TBE gel, 20% | Thermo Fisher Scientific | Cat#EC63152BOX |
Novex TBE gel, 4-40% | Thermo Fisher Scientific | Cat#EC62252BOX |
NuPage 4-12% Bis-Tris protein gels | Thermo Fisher Scientific | Cat#NP0322BOX |
NuPage Transfer Buffer (20X) | Thermo Fisher Scientific | Cat#NP006 |
Ni-NTA agarose | Qiagen | Cat#30250 |
HiTrap Heparin HP | GE Healthcare | Cat#17040601 |
HiLoad 26/600 Superdex 200 pg | GE Healthcare | Cat#289289336 |
Ulp1 protease | In-house | N/A |
Critical commercial assays | ||
Expi293 Expression System Kit | Thermo Fisher Scientific | Cat#A14635 |
Gel filtration calibration kit high molecular weight | GE Healthcare | Cat#28403842 |
iBind Flex solution kit | Thermo Fisher Scientific | Cat#SLF2020 |
Lipofectamine 3000 transfection reagents | Thermo Fisher Scientific | Cat#L3000001 |
LIVE/DEAD Fixable Violet Dead Cell Stain Kit | Thermo Fisher Scientific | Cat#L34955 |
NucSpot Live 650 kit | Biotium | Cat#40082 |
RNeasy Pus Mini Kit | Qiagen | Cat#74034 |
Superscript IV VILO master mix | Thermo Fisher Scientific | Cat#11756050 |
TruSeq Standard Total RNA LT Kit | Illumina | Cat#RS-122-1202 |
WesternEaze-Chemi kit | Advansta | Cat#K-12054-010 |
Zip Alexa Fluor 647 Rapid Antibody Labeling Kit | Thermo Fisher Scientific | Cat#Z11235 |
Deposited data | ||
NEXT-RNA substrate 1 complex structure | This paper | PDB: 7S7B |
NEXT-RNA substrate 1 complex EM maps | This paper | EMDB: EMD-24882 |
NEXT-RNA substrate 2 complex structure | This paper | PDB: 7S7C |
NEXT-RNA substrate 2 complex EM maps | This paper | EMDB: EMD-24883 |
Apo NEXT EM map | This paper | EMDB: EMD-24884 |
RNA-seq data | This paper | GEO: GSE185374 Token: ytspiamilduxlsx |
Experimental models: Cell lines | ||
Human: Expi293F cells | Thermo Fisher Scientific | Cat#A14635 |
Human: HAP1 | Horizon Discovery | Cat#C631 |
Human: HAP1 ZCCHC8 knockout | Horizon Discovery | Cat#HZGHC005158c012 |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC8, and PB-mCherry-ZCCHC8 | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC8ΔHD, and PB-mCherry-ZCCHC8 | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC81-80-ROS1kinase, and PB-mCherry-ZCCHC81-80-ROS1kinase | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ZCCHC81-80dm-ROS1kinase, and PB-mCherry-ZCCHC81-80-ROS1kinase | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP-ROS1kinase, and PB-mCherry-ROS1kinase | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP- ZCCHC81-80-ROS1kinase, and PB-mCherry-ZCCHC8 | This work | N/A |
Human: Expi293F stably transfected with PB-rtTA-Puro, PB-GFP- ROS1kinase, and PB-mCherry-ZCCHC8 | This work | N/A |
Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8 | This work | N/A |
Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8ΔHD | This work | N/A |
Human: HAP1 ZCCHC8 CRISPR knockout stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC8ΔZK | This work | N/A |
Human: HAP1 ZCCHC8 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80-ROS1kinase | This work | N/A |
Human: HAP1 ZCCHC8 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80dm-ROS1kinase | This wok | N/A |
Human: HAP1 stably transfected with PB-rtTA-Puro and PB-GFP-ZCCHC81-80-ROS1kinase(dead) | This work | N/A |
Human: HAP1 stably transfected with PB-rtTA-Puro and PB-GFP-ROS1kinase | This work | N/A |
Oligonucleotides | ||
6-FAM-AGCACCGUAAAGACGC (gel-based assay RNA top strand) | IDT | N/A |
GCGUCUUUACGGUGCUAAAAAAAAAAAAAAAAAAAA (gel-based assay bottom strand for duplex with 3′ 20-nt poly(A) overhang) | IDT | N/A |
GCGUCUUUACGGUGCUUpyAAAAAAAAAAAAAAAAA (gel-based assay bottom strand for duplex with 2′ pyrene modified uridine Upy) | Dharmacon | N/A |
ACAUGAGGAUCACCCAUGUAAUCUCUUUCAAAAAAUpyACAAAAAAAA (cryo-EM substrate 1, Upy= 2′ pyrene modified uridine) | Dharmacon | N/A |
GGCGCGCGCCAAAAAUUUUUAAAAAAAAAA (cryo-EM substrate 2) | Dharmacon | N/A |
6-FAM-AGUGCGCUGUAUCUUCAAGGCCACU (EMSA RNA top strand) | IDT | N/A |
Iowa Black RQ-AGUGCGCUGUAUCUUCAAGGCCACU-Cy5 (molecular beacon helicase assay RNA top strand) | IDT | N/A |
AGUGGCCUUGAAGAUACAGCGCACUAAAAAAAAAAAAAAAAAAAA (molecular beacon assay RNA bottom strand with 3′ 20-nt poly(A) overhang) | IDT | N/A |
AGUGGCCUUGAAGAUACAGCGCACUAAAAAUUUUUAAAAAAAAAA (molecular beacon assay RNA bottom strand with 3′ A5U5A10 overhang) | IDT | N/A |
qPCR and CRISPR screening primers | See Table S2 | N/A |
Recombinant DNA | ||
pET-28a-His10-Smt3-RBM7core | Puno and Lima, 2018 | N/A |
pET-28a- His10-Smt3-MTR4 | Puno and Lima, 2018 | N/A |
pRSF-Duet1-Smt3-ZCCHC8core | Puno and Lima, 2018 | N/A |
pRSF-Duet1-Smt3-ZCCHC8coreΔHD | This work | N/A |
pRSF-Duet1-Smt3-ZCCHC8coreΔZK | This work | N/A |
pRSF-HiS6-ncSmt3-MTR4 | This work | N/A |
pET-28a- His10-Smt3-Strep-MTR4 | This work | N/A |
pET-28a- His10-Smt3-Strep-MTR4-E253Q | This work | N/A |
pRP[Exp]-mCherry-CAG>hyPBase | VectorBuilder | Cat#VB160216-10057 |
PB-TAG-ERPE | Addgene; Kim et al., 2015 | Cat#80479, RRID:Addgene_80479 |
PB-rtTA-Puro | This work | N/A |
PB-GFP-ZCCHC8 | This work | N/A |
PB-GFP-ZCCHC8ΔNTD | This work | N/A |
PB-mCherry-ZCCHC8 | This work | N/A |
PB-GFP-ZCCHC8ΔZK | This work | N/A |
PB-GFP-ZCCHC81-80-ROS1kinase | This work | N/A |
PB-GFP-ZCCHC81-80-ROS1kinase(dead) | This work | N/A |
PB-GFP-ZCCHC81-80dm-ROS1kinase | This work | N/A |
PB-GFP-ROS1kinase | This work | N/A |
pRP[2CRISPR]-mCherry-hCas9-U6>{hZCCHC8[gRNA#1]}-U6>{hZCCHC8[gRNA#2]}) | This work | Cat#: VB200528-1045ndr |
Software and algorithms | ||
BD FACSDiva software | BD Biosciences | http://www.bdbiosciences.com/instruments/software/facsdiva/index.jsp; RRID:SCR_001456 |
Biorender | Biorender | http://biorender.com; #NI22WEQFBQ;#YI22XZN09U and #TM22XZN108 RRID:SCR_018361 |
Coot | Emsley et al., 2010 | https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/; RRID:SCR_014222 |
FCS Express Research version 7 | De Novo software company | https://denovosoftware.com/; RRID:SCR_016431 |
Gctf | Zhang, 2016 | https://www2.mrc-lmb.cam.ac.uk/research/locally-developed-software/zhang-software/#gctf; RRID:SCR_016500 |
Integrative Genomics Viewer (IGV) | Robinson et al., 2011 | https://software.broadinstitute.org/software/igv/ |
ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
Jalview version 2 | Waterhouse et al., 2009 | www.jalview.org/: RRID:SCR_006459 |
Leginon data collection software | Suloway et al., 2005 | https://emg.nysbc.org/redmine/projects/leginon; RRID:SCR_016731 |
MolProbity | Chen et al., 2010 | http://molprobity.biochem.duke.edu; RRID:SCR_014226 |
Phenix suite | Adams et al., 2010 | https://www.phenix-online.org/; RRID:SCR_014224 |
Prism version 9 | Graphpad | https://www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 |
Pymol version 2.4.1 | Schroedinger LLC | https://pymol.org; RRID:SCR_000305 |
RELION | Scheres, 2012; Zivanov et al., 2018 | http://www2.mrc-lmb.cam.ac.uk/relion; RRID:SCR_016274 |
Serial EM data collection software | Mastronarde, 2003 | http://bio3d.colorado.edu/SerialEM/; RRID:SCR_017293 |
STAR | Dobin et al., 2013 | http://code.google.com/p/rna-star/; RRID:SCR_004463 |
UCSF ChimeraX version 1.2.5 | Pettersen et al., 2021 | https://www.cgl.ucsf.edu/chimerax/; RRID:SCR_015872 |
UCSF MotionCor2 | Zheng et al., 2017 | https://emcore.ucsf.edu/ucsf-software |
Other | ||
Quantifoil R 1.2/1.3 300 mesh gold grids | Electron Microscopy Services | Cat#Q43841 |
Vitrobot Mark IV | FEI – Thermo Fisher | https://www.fei.com |
Titan Krios | FEI – Thermo Fisher | https://www.fei.com |
K2 Summit Camera | Gatan, Inc | www.gatan.com |
K3 Camera | Gatan, Inc | www.gatan.com |
Corning 3693 White Half-Area 96-well plate | Fisher Scientific | Cat#07-200-326 |
Trans-blot Turbo | Bio-Rad | Cat#1704150 |
iBind Flex Western device | Thermo Fisher Scientific | Cat#SLF2000 |