Table 1.
Yeast strains, plasmids, and genes used in this study
| Strains | |||
|---|---|---|---|
| Name | Code | Description | References |
| Parent strains | |||
| CEN.PK111-9A | H3892 | S. cerevisiae (MATa his3-Δ1 URA3 leu2-3,112 TRP1 MAL2-8c SUC2) | a |
| CEN.PK113-7D | H3887 | S. cerevisiae (MATa HIS3 URA3 LEU2TRP1 MAL2-8c SUC2) | a |
| PHB production strains | |||
| PHB_glu | H5696 | H3887 with integration of phaA, phaB1, and phaC1 genes into X-3 EasyClone locus (plasmid B11787) | This article |
| PHB_cbp | H5716 | H3892 with integration of phaA, phaB1, and phaC1 genes into X-3 EasyClone locus and ura3Δ::cbp (from plasmid B9403), CDT-1 (plasmid B8444) | This article |
| PHB_GH1-1 | H5717 | H3892 with integration of phaA, phaB1, and phaC1 genes into X-3 EasyClone locus, ura3Δ::GH1-1 (from plasmid pSS20), CDT-1 (plasmid B8444) | This article |
| Control strains | |||
|---|---|---|---|
| cbp_control | H5718 | H3892 ura3Δ::cbp (from plasmid B9403), CDT-1 (plasmid B8444) | This article |
| GH1-1_control | H5719 | H3892 ura3Δ::GH1-1 (from plasmid pSS20), CDT-1 (plasmid B8444) | This article |
| Plasmids | ||
|---|---|---|
| Code | Description | References |
| B11787 | pTEF1-phaA-tENO1-pTDH3-phaB1-tSSA1-pPGK1-phaC1-tCYC | This article |
| B9403 | pPGK1-cbp-1-tENO1, LEU2, 2µ, kanR | This article |
| pSS20 | pADH1-GH1-1-tENO1, LEU2, CEN/ARS, kanR | [28] |
| B8444 | pPGK1-CDT-1-tENO1, URA3, CEN/ARS, kanR | [28] |
| Primers | ||
|---|---|---|
| Code | Sequence | References |
| oJR004 | CCGACATAAGCTGGACCAGTA | This article |
| oJR025 | TTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCGGAAAGAGTGAGGAACTATCGCATA | This article |
| oJR026 | TAATTAAATTGAAGCTCTAATTTGTGAGTTTAGTATACATGCATTTACTTATAATACAGTTTTTCTGCCTATTTAACGCCAACGTTG | This article |
| oJR064 | ACGAAGGAAGGAGCACAGAC | This article |
| oJR065 | GACCGAGATTCCCGGGTAAT | This article |
| Genes | Code | Source | References |
|---|---|---|---|
| Name | |||
| Acetyl-CoA acetyltransferase | phaA | Cupriavidus necator, GenBank KP681582 | [30] |
| Acetoacetyl-CoA reductase | phaB1 | C. necator, GenBank KP681583 | [30] |
| PHA synthase | phaC1 | C. necator, GenBank KP681584 | [30] |
| Cellobiose phosphorylase | cbp | Ruminococcus flavefaciens FD-1, GenBank NZ_ACOK01000116.1 | [31] |
| β-glucosidase | GH1-1 | Neurospora crassa, NCU00130, GenBank 3872338 | [13] |
| Cellobiose transporter | CDT-1 | N. crassa, NCU00801, GenBank 3879950 | [13] |
aStrains were kindly provided by Dr. P. Kötter (Institut für Mikrobiologie, J.W. Goethe Universität Frankfurt, Germany)