REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-mouse CD11b-FITC (M1/70)	In-house
Anti-mouse CD11b-AF700 (M1/70)	BD Biosciences	Cat# 557960, RRID: AB_396960
Anti-mouse CD11b-APC (M1/70)	BioLegend	Cat# 10128
Anti-mouse CD11b-PE-e610	eBioscience	Cat# 61-0112-82, RRID: AB_2574528
Anti-mouse CD11c-PE-Cy7 (HL3)	BD Biosciences	Cat# 558079, RRID: AB_647251
Anti-mouse CD16/32	eBioscience	Cat# 14-0161-86, RRID: AB_467135
Anti-mouse CD19-FITC (1D3)	BD Biosciences	Cat# 561740, RRID: AB_10893811
Anti-mouse CD45-APC-e780 (30-F11)	eBioscience	Cat# 47-0454-82, RRID: AB_1272175
Anti-mouse CD45-e506	eBioscience	Cat# 69-0454-82, RRID: AB_2637105
Anti-mouse CD64-PerCP-e710	eBioscience	Cat# 46-0641-82, RRID: AB_2735016
Anti-mouse F4/80-PE (CI:A3-1)	Cedarlane labs	Cat# CL8940PE, RRID: AB_10060422
Anti-mouse F4/80-A647 (T45-2342)	BD Biosciences	Cat# 565853, RRID: AB_2744474
Anti-mouse Gr1-PE (RB6-8C5)	BD Biosciences	Cat# 553128, RRID: AB_394644
Anti-mouse Ly6C-Biotin (AL-21)	BD Biosciences	Cat# 557359, RRID: AB_396663
Anti-mouse Ly6C-BV605 (AL-21)	BD Biosciences	Cat# 563011, RRID: AB_2737949
Anti-mouse Ly6G-AF700 (1A8)	BD Biosciences	Cat# 561236, RRID: AB_10611860
Anti-mouse Ly6G-PE (1A8)	BD Biosciences	Cat# 551461, RRID: AB_394208
Anti-mouse Ly6G-APC (1A8)	BD Biosciences	Cat# 560599, RRID: AB_172756
Anti-mouse MHCII-BV786 (M5/114.15)	BD Biosciences	Cat# 742894, RRID: AB_2734759
Anti-mouse TCRβ-e450 (H57-597)	eBioscience	Cat# 48-5961-82, RRID: AB_11039532
Anti-mouse Iba-1	Wako, Japan	N/A
Goat anti-rabbit IgG H&L-AF568	Life Technologies	N/A
Anti-rabbit IgG-biotin	Dako Cytomation	N/A
Chemicals, peptides, and recombinant proteins
Sodium pentobarbitone	Virbac, Peakhurst, Australia	N/A
Liquid DAB+ Substrate Chromagen System	Dako	K3468
Collagenase from clostridium histolyticum	Sigma Aldrich	C5138
Deoxyribonuclease I	Sigma Aldrich	DN25
LIVE/DEAD Fixable Aqua	Invitrogen	L34957
Fixable Viability eFluor 780	eBioscience	65-0865-14
Sodium thioglycollate	Sigma Aldrich	T0632
FITC-isolectin B4 (from Bandeiraea simplicifolia (Griffonia simplicifolia))	Sigma Aldrich	L2895
Hoescht33342	ThermoFisher	H1399
Alexa 488-Phalloidin	Invitrogen	A12379
DePeX mounting medium	VWR International Ltd., Poole, England	SERA18243.01
Mouse recombinant KC (CXCL1)	Peprotech	250-11
Mouse recombinant CSF-1	Peprotech	315-02
Mouse recombinant IL-4	eBiosciences	14-8041-80
Mouse recombinant IL-13	eBiosciences	14-8131-80
Mouse recombinant IFN-γ	eBiosciences	14-8311-63
LPS-EB Ultrapure	Invivogen	Tlrl-3pelps
Critical commercial assays
Vectastain ABC kit, standard	Vector Laboratories	PK-4000
Mouse albumin ELISA kit	Bethyl Laboratories, Mongomery, TX, USA	E99-134
Experimental models: Organisms/strains
WT C57Bl/6	In-house breeding, Animal Research Laboratories, Clayton, Australia	N/A
Cd82−/− C57Bl/6	In-house breeding, Animal Research Laboratories, Clayton, Australia	N/A
L. mexicana	In-house propagation	N/A
L. mexicanaTurboRFP	In-house propagation	N/A
Oligonucleotides
Arginase 1 (Arg1)-forward primer: CCACAGTCTGGCAGTTGGAA	Bioneer Pacific	N/A
Arginase 1 (Arg1)-reverse primer: GCATCCACCCAAATGACACA	Bioneer Pacific	N/A
Arginase 1 (Arg1)-probe: FAM-TGGCCACGCCAGGGTCCAC-TAMRA	Bioneer Pacific	N/A
Mannose receptor (Mrc1)-forward primer: AATACCTTGAACCCATTTATCATTCC	Bioneer Pacific	N/A
Mannose receptor (Mrc1)-reverse primer: GCATAGGGCCACCACTGATT	Bioneer Pacific	N/A
Mannose receptor (Mrc1)-probe: FAM-CGATGTGCCTACCGGCTGCCC-TAMRA	Bioneer Pacific	N/A
Nitric oxide synthase (Nos2)-forward primer: GGGCAGCCTGTGAGACCTT	Bioneer Pacific	N/A
Nitric oxide synthase (Nos2)-reverse primer: TGCATTGGAAGTGAAGCGTTT	Bioneer Pacific	N/A
Nitric oxide synthase (Nos2)-probe: FAM- TCCGAAGCAAACATCACATTCAGATCCC-TAMRA	Bioneer Pacific	N/A
Software and algorithms
FlowJo	TreeStar Inc, OR, USA	N/A
GraphPad Prism (version 6)	San Diego, CA USA	N/A
ImageJ	NIH, MA, USA	N/A
Other
PROOX 110 gas regulator	Reming Bioinstruments Co., Redfield NY USA	N/A
Nikon A1 laser scanning confocal microscope	Nikon Instruments Inc, Melville, NY, USA	N/A
Leica SP8 inverted confocal microscope	Leica Microsystems Pty Ltd, NSW, Australia	N/A
ZEISS LSM980 Axioplan 2 microscope	ZEISS Australia, North Ryde, NSW	N/A
LSR II Fortessa cell analyser	BD Biosciences Australia	N/A
Transwells 65 mm diameter 5.0 μm pore size	DKSH	3421
Caliper Vernier, Digital LCD	Westlab Pty Ltd	080322-0003