Table 1.
Vector name | sgRNA sequence | HIV-1 provirus ligation sitea | HIV-1 genome position | Position from 5′LTR TSS |
---|---|---|---|---|
pLTR1 | 5′CCACGTGATGAAATGCTAGG3′ | 3′LTR U3 | 9360–9379 | + 8924 |
pLTR2 | 5′CCGCCTAGCATTTCATCACG3′ | 3′LTR U3 | 9357–9376 | + 8921 |
pLTR3 | 5′TGCCTGGCTAGAAGCACAAG3′ | NEF | 8961–8980 | + 8525 |
pLTR4 | 5′CTGTGGATCTACCACACACA3′ | 5′LTR U3/3′LTR U3 | 45–64/9130–9149 | − 391 |
pLTR5 | 5′CTACAAGGGACTTTCCGCTG3′ |
5′LTR U3R 3′LTR U3R |
344–363/9429–9448 | − 92 |
pLTR—expression vector containning sgRNA, the dCas9 and KRAB domain
aSequence from subtype B group M HIV-1