Skip to main content
. 2022 May 3;11:e76555. doi: 10.7554/eLife.76555

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene (Pseudomonas aeruginosa) PA14 NCBI Accession: GCF_000014625.1 Reference file
Strain, strain background (Saccharomyces cerevisiae) Saccharomyces cerevisiae PMID:16820502 Cloning yeast
Strain, strain background (Escherichia coli) DH5a Invitrogen Electrocompetent cells
Strain, strain background (Escherichia coli) S17 λpir PMID:8226632 Electrocompetent cells made in lab
Strain, strain background (P. aeruginosa) PA14 WT PMID:7604262 Hogan Laboratory reference strain
Strain, strain background (P. aeruginosa) DH2417; NC-AMT0101-1-2 PMID:16687478 Chronic CF lung infection isolate with functional LasR allele
Strain, strain background (P. aeruginosa) PA14 WT PMID:33771779 Laub Lab; strain background of kinase clean deletion mutants
Genetic reagent (P. aeruginosa) PA14 ∆lasR PMID:15554963
Genetic reagent (P. aeruginosa) PAO-MW1qsc102 PMID:10570171; PMID:11544214 AHL-sensing bioreporter; PAO1 lasIrhlI mutant with Tn5-B22, which contains promoterless lacZ located within PA1896 (hypothetical protein) at chromosomal location of 2,067,716. Responsive to 3OC12-HSL but not C4-HSL.
Genetic reagent (P. aeruginosa) PAO-MW1qsc131 PMID:10570171; PMID:11544214 AHL-sensing bioreporter; PAO1 lasIrhlI mutant with Tn5-B22, which contains promoterless lacZ, under phzC promoter control. Responsive to either 3OC12-HSL or C4-HSL but requires both for full activation.
Genetic reagent (P. aeruginosa) PA14 WT att::lacZ PMID:31980538 PA14 WT with constitutive expression of lacZ for competition assays
Genetic reagent (P. aeruginosa) PA14 ∆cheA PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆chpA PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆creC PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆uhpB PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆bfiS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆bphP PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_10770 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_11630 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆rocS1 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆narX PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆wspE PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_19340 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆mxtR PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆cpxS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆gtrS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_24340 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆rocS2 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_26810 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆sagS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆copS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pfeS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆bqsS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_30700 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_30840 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆czcS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_32570 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_36420 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆ercS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆exaD PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆ercS’ PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆parS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆kdpD PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_43670 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_45590 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_45870 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_46370 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_46980 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_48160 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆phoQ PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_49420 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆fleS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pirS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆gacS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆tctE PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pprA PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆colS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_57170 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆roxS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆rcsC PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pvrS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pilS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆cbrA PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆pmrB PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆retS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_64580 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆aruS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆ntrB PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_68230 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆amgS PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆algZ PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆phoR PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆kinB PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆PA14_72740 PMID:33771779
Genetic reagent (P. aeruginosa) PA14 ∆rhlR PMID:30936375
Genetic reagent (P. aeruginosa) PA14 ∆anr PMID:31527114
Genetic reagent (P. aeruginosa) PA14 ∆cbrB This paper PA14 WT with in-frame deletion of cbrB (PA14_62540)
Genetic reagent (P. aeruginosa) PA14 cbrB::TnM PMID:22911607; PMID:16477005 cbrB MAR2xT7 transposon insertion mutant
Genetic reagent (P. aeruginosa) DH2417∆cbrB; NC-AMT0101-1-2∆cbrB This paper CF clinical isolate NC-AMT0101-1-2 (DH2417) with in-frame deletion of cbrB (PA14_62540)
Genetic reagent (P. aeruginosa) PA14 ∆crc This paper PA14 WT with in-frame deletion of crc (PA14_70390)
Genetic reagent (P. aeruginosa) PA14 ∆crc + crc This paper PA14 ∆crc with complementation of crc (PA14_70390) at the native locus
Genetic reagent (P. aeruginosa) PA14 ∆lasR + lasR PMID:31980538
Genetic reagent (P. aeruginosa) PA14 ∆cbrB + pMQ70 cbrB (plasmid) This paper PA14 ∆cbrB expressing arabinose inducible pMQ70 cbrB expression vector
Genetic reagent (P. aeruginosa) PA14 ∆lasRcbrB This paper PA14 ∆lasR with in-frame deletion of cbrB (PA14_62540)
Genetic reagent (P. aeruginosa) PA14 ∆lasRcbrB + cbrB This paper PA14 ∆lasRcbrB with complementation of cbrB (PA14_62540) at the native locus
Genetic reagent (P. aeruginosa) PA14 ∆lasRcbrB∆crc This paper PA14 ∆lasRcbrB with in-frame deletion of crc (PA14_70390)
Genetic reagent (P. aeruginosa) PA14 ∆lasR∆crc This paper PA14 ∆lasR with in-frame deletion of crc (PA14_70390)
Genetic reagent (P. aeruginosa) PA14 ∆lasR∆crc + crc This paper PA14 ∆lasRcrc with complementation of crc (PA14_70390) at the native locus
Genetic reagent (P. aeruginosa) PA14 + pMQ72 EV This paper PA14 WT expressing pMQ72 empty vector
Genetic reagent (P. aeruginosa) PA14 + pMQ70 cbrB This paper PA14 WT expressing arabinose inducible pMQ70 cbrB expression vector
Genetic reagent (P. aeruginosa) PA14 + pMQ72 crcZ This paper PA14 WT expressing arabinose inducible pMQ72 crcZ expression vector
Recombinant DNA reagent pMQ30 EV PMID:16820502
Recombinant DNA reagent pMQ72 EV PMID:16820502
Recombinant DNA reagent pMQ70 EV PMID:16820502
Recombinant DNA reagent pMQ30_cbrB_KO This paper pMQ30 plasmid for knocking out cbrb
Recombinant DNA reagent pMQ30_crc_KO This paper pMQ30 plasmid for knocking out crc
Recombinant DNA reagent pMQ30_cbrB_KON This paper pMQ30 plasmid for complementing cbrb at the native locus
Recombinant DNA reagent pMQ30_crc_KON This paper pMQ30 plasmid for complementing cbrb at the native locus
Recombinant DNA reagent pMQ72_crcZ This paper pMQ72 plasmid backbone with arabinose inducible crcZ expression
Recombinant DNA reagent pMQ70_cbrB This paper pMQ70 plasmid backbone with arabinose inducible cbrB expression
Sequence-based reagent pMQ72 crcZ OE 1 F This paper PCR Primers; construct design gtttctccatacccgtttttttgggctagcGCACAACAACAATA ACAAGCAACGACGAAG
Sequence-based reagent pMQ72 crcZ OE 2 R This paper PCR Primers; construct design ctagaggatccccgggtaccgagctcgaattcgaaatggtgtaaggcgaaggaaaaacgg
Sequence-based reagent pMQ70 cbrB OE 1 F This paper PCR Primers; construct design ctctctactgtttctccatacccgtttttttgggctagcgAGACGAGCgaattcACGTCGAGAGAGCtgaatacatggcac
Sequence-based reagent pMQ70 cbrB OE 2 R This paper PCR Primers; construct design ttgcatgcctgcaggtcgactctagaggatccccgggtacGTAACAGGTTGCAGGGTaccGTtacgagtcggccgaggcccc
Sequence-based reagent pMQ30 cbrB KO 1 F This paper PCR Primers; construct design taacaatttcacacaggaaacagctatgaccatgattacgaattcAGGAAGTGCTGATGTGGAACC
Sequence-based reagent pMQ30 cbrB KO 2 R This paper PCR Primers; construct design GTAACAGGTTGCAGGGTGTTTATTCAGCTCTCTCGACGTGCT
Sequence-based reagent pMQ30 cbrB KO 3 F This paper PCR Primers; construct design CACGTCGAGAGAGCTGAATAAACACCCTGCAACCTGTTACC
Sequence-based reagent pMQ30 cbrB KO 4 R This paper PCR Primers; construct design aggtcgactctagaggatccccgggtaccgagctcgaattcCAGGGAGTGCTGGTTGTTACCGATGACTtc
Sequence-based reagent pMQ30 crc KO 1 F This paper PCR Primers; construct design taacaatttcacacaggaaacagctatgaccatgattacgaattcTGGAATACAGGCGCAGCAac
Sequence-based reagent pMQ30 crc KO 2 R This paper PCR Primers; construct design TAGAAAAGCCGGCGCATGCGCTGGCTTTTTCGTGTCTGACGGGGCAAATGGCCCCCAAAATCACGTGCG
Sequence-based reagent pMQ30 crc KO 4 R This paper PCR Primers; construct design ctgcaggtcgactctagaggatccccgggtaccgagctcgaattcttggctgaccgccgagtacggcatgc
Sequence-based reagent pMQ30 crc KO 3 F This paper PCR Primers; construct design TTTGAGCTCGGGTATCATACACGCACGTGATTTTGGGGGCCATTTGCCCCGTCAGACACGAAAAAGCCAG
Sequence-based reagent cbrB check F This paper PCR primer, KO check GCGTCTGCTCCCTGGCCAAG
Sequence-based reagent cbrB check R This paper PCR primer, KO check GTGGCGCTGGTGGCGACATC
Sequence-based reagent crc check F This paper PCR primer, KO check GCTCGATGGCGAAACGAATG
Sequence-based reagent crc check R This paper PCR primer, KO check GCGCTGGTGTTGACCATCATC
Sequence-based reagent crcZ RT 1 F PMID:31911486 PCR Primers GCACAACAACAATAACAAGCAACG
Sequence-based reagent crcZ RT 2 R PMID:31911486 PCR Primers AGTTTTATTCTTCTTCCGACTGGCT
Sequence-based reagent rpsL RT1F PMID:31911486 PCR Primers GTAAGGTATGCCGTGTACG
Sequence-based reagent rpsL RT 2 R PMID:31911486 PCR Primers CACTACGCTGTGCTCTTG
Sequence-based reagent rpoD RT 1 F PMID:30936375 PCR Primers CGCCGAGATCAAGGAAATCA
Sequence-based reagent rpoD RT 2 R PMID:30936375 PCR Primers TACTTCTTGGCGATGGAAATCA
Commercial assay, kit NEBuilder HiFi DNA Assembly Biolabs Cat. #: E2621L Gibson cloning
Commercial assay, kit Master Pure Yeast DNA purification kit Lucigen Cat. No.: MPY80200
Commercial assay, kit RNAeasy Mini kit QIAGEN Cat. No.: 74,104
Commercial assay, kit Turbo DNA-free kit Thermo Fisher Scientific AM1907
Commercial assay, kit RevertAid H Minus First Strand cDNA synthesis Thermo Scientific Cat. No.: EP0451 cDNA synthesis with IDT random hexamer
Commercial assay, kit SsoFast EvaGreen Supermix BIO-RAD Cat.#: 1725201
Commercial assay, kit Zymoprep Yeast Plasmid Miniprep II Zymo Research Cat. No.: D2004 Yeast cloning
Commercial assay, kit Biocrates AbsoluteIDQ p180 kit biocrates Amino acid. quantification
Chemical compound, drug Brain Heart Infusion BD SKU:211,059 BBL Brain Heart Infusion
Chemical compound, drug Agar BD SKU:214,510 Difco Agar, granulated (2 Kg pail)
Chemical compound, drug XGAL; 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside Research Products International B71800-5.0 Stock dissolved in DMSO
Chemical compound, drug Fluoroacetamide Aldrich 128341–5 G dissolved in water, filter sterilized
Chemical compound, drug Lactamide Tokyo Chemical Industry Product Number: L0001
Chemical compound, drug Mannitol Sigma M8429-500G D-Mannitol
Chemical compound, drug Succinate Sigma S9512-500G Succinic acid, to pH7 with NaOH
Chemical compound, drug Phenylalanine Sigma-Aldrich P2126-100G L-Phenylalanine
Chemical compound, drug Arginine Sigma A5131-100G L-arginine monohydrochloride
Chemical compound, drug Lactate Fisher Scientific S326-500 Sodium lactate syrup, 60% w/w
Chemical compound, drug Glucose VWR Chemicals BDH9230-2.5KG Dextrose, anhydrous
Chemical compound, drug Citrate FisherScientific A104-500 Citric acid, monohydrate
Chemical compound, drug Gentamicin Research Products International G38000-10.0 Gentamicin Sulfate
Chemical compound, drug Nalidixic acid Research Products International N42000-25.0
Chemical compound, drug Carbinicillin Goldbio C-103–25 Carbenicillin (Disodium)
Chemical compound, drug Sucrose Fisher BioReagents BP220-212; 2.5 kg D-Sucrose
Chemical compound, drug HEPES SIGMA H3375-100G buffer
Chemical compound, drug Tryptone Fisher Bioreagents BP1421-500 LB
Chemical compound, drug NaCl; sodium chloride Fisher Chemical S271-3 LB
Chemical compound, drug Yeast extract Fisher Bioreagents BP1422-500 LB
Chemical compound, drug Ammonium sulfate Fisher Chemical A702-500 M63
Chemical compound, drug Potassium phosphate monobasic Fisher Chemical P382-500 M63
Chemical compound, drug Potassium phosphate dibasic, anhydrous Fisher Chemical P288-500 M63
Chemical compound, drug Magnesium Sulfate Fisher Scientific M63-500 M63
Chemical compound, drug Milk BD 232,100 Difco Skim Milk
Chemical compound, drug Yeast Nitrogen Base without amino acids Research Products International Y20040-500.0 Yeast cloning
Chemical compound, drug Yeast Synthetic Drop-out Medium Supplements without uracil Sigma Y1501-20G Yeast cloning
Chemical compound, drug Peptone Fisher bioreagents BP1420-500 YPD
Chemical compound, drug Sodium phosphate dibasic anhydrous Fisher Chemicals S374-500 ASM
Chemical compound, drug Sodium phosphate monobasic Fisher Chemicals S369-500 ASM
Chemical compound, drug Potassium Nitrate Fisher Chemicals M-12636 ASM
Chemical compound, drug Potassium Sulfate Fisher Chemicals P304-500 ASM
Chemical compound, drug L-(+)-Lactic acid Sigma L1750-10G ASM; 1 M stock; pH to 7 with NaOH
Chemical compound, drug Calcium chloride dihydrate Sigma C7902-500G ASM
Chemical compound, drug Magnesium Chloride Hexahydrate Fisher chemical M33-500 ASM
Chemical compound, drug FeSO4*7H2O Sigma-Aldrich F-8048 ASM; Ferrous sulfate heptahydrate; Filter sterilized
Chemical compound, drug N-acetylglucosamine Fisher Scientific AAA1304718 ASM
Chemical compound, drug DPPC Sigma P0763-250MG ASM; 1,2-dipalmitoyl-sn-glycero-3-phosphocholine; dissolved in chloroform
Chemical compound, drug Tryptophan Sigma-Aldrich T0254-25G ASM, L-Tryptophan
Chemical compound, drug Mucin Sigma M2378-100G ASM; Mucin from porcine stomach, Type II
Peptide, recombinant protein Phusion New England BioLabs M0530L High-Fidelity DNA polymerase
Software, algorithm MATLAB MathWorks
Software, algorithm breseq PMID:24838886 Version 0.35.4
Software, algorithm bcl2fastq Illumina RRID:SCR_015058 v2.20.0422
Software, algorithm GraphPad Prism 9 GraphPad Version 9.2.0