Table 1.
Nested PCR primers for detection of the nucleocapsid phosphoprotein (N) gene of SARS-CoV-2.
| Primer | Sequence (5′–3′) | Position a | Annealing b (T°C) |
Size (bp) |
|---|---|---|---|---|
| Ext2019nCorVF | GGCAGTAACCAGAATGGAGA | 28346–28365 | 54.6 | 335 |
| Ext2019nCorVR | CTCAGTTGCAACCCATATGAT | 28681–28661 | ||
| intF | CACCGCTCTCACTCAACAT | 28432–28450 | 54.6 | 212 |
| intR | CATAGGGAAGTCCAGCTTCT | 28643–28624 |
a The primers were designed according to the position of the N gene in the SARS-CoV-2 genome, sequence MN908947.3, isolate Wuhan-Hu-1: 28274–29533 [4]. b Annealing temperature according to QB96 software (Quanta Biotech, Surrey, UK).