| Primers | sequence |
|---|---|
| F1 | taaccctaattcttatcctttacttcaggcggccgcaacatggtgagcaagggcgagga |
| F2 | agatgccgtctgacaagaccgtgggcggaggtgatgCctcgttcaacaccttcttcagc |
| F3 | ccctggagcattccgCctgcgccttcatggtcgaca |
| R1 | ctccgcccacggtcttgtcagacggcatctggccaGcgggctggatgccgtgctc |
| R2 | accatgaaggcgcagGcggaatgctccagggtggtg |
| R3 | acagaagtaaggttccttcacaaagatcctctagattagtactcctcagcgccct |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.