| Gene (Homo sapiens) |
TUBA1A
|
NCBI |
Gene ID: 7846 |
|
| Gene (Saccharomyces cerevisiae) |
TUB1
|
Saccharomyces genome database |
SGD:S000004550 |
|
| Gene (Saccharomyces cerevisiae) |
TUB3
|
Saccharomyces genome database |
SGD:S000004593 |
|
| Biological sample (Mus musculus) |
In utero electroporation coronal brain slices |
This paper |
|
Coronal slices of E18.5 mouse brains |
| Biological sample (Rattus norvegicus) |
Primary cortical rat neurons |
This paper |
|
Cortices obtain from P0-P2 rats |
| Recombinant DNA reagent |
pCIG2-TUBA1A-6X-His |
Buscaglia et al., 2020a
|
|
Human TUBA1A plasmids transfected in mouse or rat neurons |
| Recombinant DNA reagent |
pCIG2-TUBA1A-IRES-GFP-MACF43 |
Aiken et al., 2019
|
|
Plasmid to co-express human TUBA1A and GFP-MACF43 in rat neurons |
| Sequence-based reagent |
TUBA1A-V409A F QC |
This paper |
PCR primer; p674 |
ctttgttcactggtacgctggggaggggatg |
| Sequence-based reagent |
TUBA1A-V409A R QC |
This paper |
PCR primer; p675 |
catcccctccccagcgtaccagtgaacaaag |
| Sequence-based reagent |
TUBA1A-V409I F QC |
This paper |
PCR primer; p986 |
cctttgttcactggtacattggggaggggatgg |
| Sequence-based reagent |
TUBA1A-V409I R QC |
This paper |
PCR primer; p987 |
ccatcccctccccaatgtaccagtgaacaaagg |
| Sequence-based reagent |
tub1-V410A F |
This paper |
PCR primer; p545 |
CGTCCACTGGTATGCCGGTGAAGGTATG |
| Sequence-based reagent |
tub1-V410A R |
This paper |
PCR primer; p546 |
CATACCTTCACCGGCATACCAGTGGACG |
| Sequence-based reagent |
tub1-V410I F |
This paper |
PCR primer; p1018 |
cgtgctttcgtccactggtatatcggtgaaggt |
| Sequence-based reagent |
tub1-V410I R |
This paper |
PCR primer; p1019 |
accttcaccgatataccagtggacgaaagcacg |
| Commercial assay, kit |
Amaxa rat nucleofector kit |
Lonza |
VPG-1003 |
For transfecting primary cortical neurons |
| Antibody |
Anti-acetylated tubulin (mouse monoclonal) |
Sigma |
T7451 |
IF (1:1000) |
| Antibody |
Anti-tyrosinated tubulin (rat monoclonal) |
Sigma |
MAB1864-I |
IF (1:1000) |
| Antibody |
Anti-6X-His (mouse monoclonal) |
Invitrogen |
4A12E4 37–2900 |
IF (1:500) |
| Antibody |
Anti-beta II tubulin (rabbit monoclonal) |
Abcam |
ab179512 |
IF (1:500) |
| Antibody |
Anti-rabbit IgG AF568 (goat polyclonal) |
Thermo |
A-11011 |
IF (1:200) |
| Antibody |
Anti-rat IgG AF568 (goat polyclonal) |
Thermo |
A-11077 |
IF (1:200) |
| Antibody |
Anti-mouse IgG AF647 (goat polyclonal) |
Thermo |
A32728 |
IF (1:200) |
| Other |
DAPI fluoromount-G |
Southern Biotech |
0100–20 |
Used in Figure 1C and D
|
| Recombinant DNA reagent |
pGEX6p1-GST-STU2 1–590 |
Widlund et al., 2012
|
|
Expression of GST-fused Stu2 TOG1/2 domains |
| Recombinant DNA reagent |
pRS426-GAL-Tub1-internal 6X-His |
Johnson et al., 2011
|
|
Overexpress α-tubulin in yeast |
| Recombinant DNA reagent |
pRS424-GAL-Tub2 (untagged) |
Johnson et al., 2011
|
|
Overexpress β-tubulin in yeast |
| Strain, strain background (Saccharomyces cerevisiae) |
Jel1 |
Lindsley and Wang, 1993
|
|
Protease deficient yeast strain used for expressing tubulin for purification |
| Strain, strain background (Saccharomyces cerevisiae) |
YEF473 |
Bi and Pringle, 1996
|
|
Lab yeast strain used for all genetic and cell biology experiments |
| Strain, strain background (Saccharomyces cerevisiae) |
Stu2 depletion strains |
Kosco et al., 2001
|
In this paper, y4835, y4836 |
Depletion of Stu2 from strain upon addition of 500 µM CuSO4
|
| Strain, strain background (Escherichia coli) |
BL21 |
Invitrogen |
D1306 |
Competent bacterial cells |
| Software, algorithm |
U-Track |
Applegate et al., 2011
|
|
Tracking microtubule plus ends in Figure 3E–H
|
