Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | CBS | NCBI | NM_000071.3 | |
| Strain, strain background (Mus musculus) | NOD scid gamma mouse | Peter MacCallum Cancer Centre Animal Facility, Australia | ||
| Cell line (Homo sapiens) | BJ-TERT human foreskin fibroblast | Provided by Robert Weinberg (Massachusetts Institute of Technology, Cambridge, MA) | BJ3 human skin fibroblasts expressing telomerase reverse transcriptase. Cultured in DMEM+20 mM HEPES, 17% Medium 199, 15% FBS, and 1% GlutaMAX | |
| Cell line (Homo sapiens) | IMR90 | Originated from ATCC and obtained from the Garvan Institute of Medical Research, Sydney, Australia | ATCC-CL-186 | Cultured in EMEM+10% FBS, 5 mM sodium pyruvate, 1% non-essential amino acids, and 1% GlutaMAX |
| Cell line (Homo sapiens) | AGS | ATCC | ATCC-CRL-1739 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | Hs 746T | ATCC | ATCC-HTB-135 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | KATO III | ATCC | ATCC-HTB-103 | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | NCI-N87 | ATCC | ATCC-CRL-5822 | Cultured in RPMI+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | SNU1 | ATCC | ATCC-CRL-5971 | Cultured in RPMI+20 mM HEPES, 10% FBS, and 1% GlutaMAX |
| Cell line (Homo sapiens) | SNU5 | ATCC | ATCC-CRL-5973 | Cultured in IMDM, 20%FBS, and 1% GlutaMAX. |
| Cell line (Homo-sapiens) | GES-1 | Provided by Prof. Caiyun Fu (Zhejiang Sci-Tech University, China) | Cultured in DMEM+20 mM HEPES, 10% FBS, and 1% GlutaMAX | |
| Recombinant DNA reagent | pBabe-puro (plasmid) | Morgenstern and Land, 1990 | Addgene plasmid #1764 | Retroviral vector as the backbone of all pBabe constructs, used as empty vector control |
| Recombinant DNA reagent | pBabe-puro-HA-myrAKT1 (plasmid) | Astle et al., 2012 | pBabe-puro construct expressing HA-tagged myrAKT1 | |
| Recombinant DNA reagent | pBabe-puro-HRASG12V | Astle et al., 2012 | pBabe-puro construct expressing HA- tagged HRASG12V, gift from Patrick Humbert | |
| Recombinant DNA reagent | pCW57.1-HA-myrAKT1 | Chan et al., 2020 | Doxycycline-inducible pCW57.1 construct expressing HA-tagged myrAKT1 | |
| Recombinant DNA reagent | pREBIR (TRE3G-dsRed-miRE/shRNA-PGK-eBFP2-IRES-rtTA3) | Kim et al., 2018 | Retroviral doxycycline-inducible shRNA expression vector as the backbone of pREBIR constructs | |
| Recombinant DNA reagent | pREBIR-shREN | Chan et al., 2020 | Doxycycline-inducible pREBIR construct expressing renilla luciferase sequence | |
| Recombinant DNA reagent | pREBIR-shCBS#1 | This paper | Doxycycline-inducible pREBIR construct expressing shRNA targeting CBS. The shRNA hairpins were subcloned from Dharmacon pGIPZ-shCBS (Cat# V3LHS_363331) | |
| Recombinant DNA reagent | pREBIR-shCBS#2 | This paper | Doxycycline-inducible pREBIR construct expressing shRNA targeting CBS. The shRNA hairpins were subcloned from Dharmacon pGIPZ-shCBS (Cat# V3LHS_363334) | |
| Recombinant DNA reagent | pRT3-puro | This paper | Retroviral doxycycline-inducible vector which is modified from pREBIR by excising the dsRed/mire cassette and replacing eBFP2 with the puromycin resistance gene | |
| Recombinant DNA reagent | pRT3-puro-CBS | This paper | Retroviral doxycycline-inducible vector pREBIR-puro expressing CBS cDNA which encodes human CBS isoform1 | |
| Recombinant DNA reagent | pLNCX2 ER:ras | Masashi Narita (Young et al., 2009) | Addgene plasmid #67844 | 4-Hydroxytamoxifen-inducible ER:ras fusion protein as the backbone for pLNCX2 ER constructs |
| Recombinant DNA reagent | pLNCX2 ER:CBS WT-FLAG | This paper | HRASV12 in pLNCX2 ER;ras was replaced with C-terminally FLAG tagged human CBS isoform 1 | |
| Recombinant DNA reagent | pLNCX2 ER:CBS Δ468–551-FLAG | This paper | HRASV12 in pLNCX2 ER;ras was replaced with C-terminally FLAG tagged human CBS isoform 1 with a deletion of regulatory domain CBSD2 (Δ468–551) | |
| Recombinant DNA reagent | FgH1t-puro-PTEN gRNA | This paper | FgH1t-puro was modified from FgH1t-GFP (Marco Herold) to replace GFP with a puromycin resistance gene. Lentiviral vector expressing PTEN gRNA sequence (TCATCTGGATTATAGACCAG) | |
| Transfected construct (Homo sapiens) | pGIPZ-Non-silencing lentiviral shRNA control | Dharmacon (Horizon Discovery, UK) | Cat#RHS4348 | Lentiviral construct to transfect and express shRNA whose sequence contain no homology to known mammalian genes as the negative control for shRNA experiments |
| Transfected construct (Homo sapiens) | pGIPZ-shCBS #1 | Dharmacon (Horizon Discovery, UK) | Cat# V3LHS_363331 | Lentiviral construct to transfect and express the shRNA targeting human CBS |
| Transfected construct (Homo sapiens) | pGIPZ-shCBS #2 | Dharmacon (Horizon Discovery, UK) | Cat# V3LHS_363334 | Lentiviral construct to transfect and express the shRNA targeting human CBS |
| Transfected construct (Homo sapiens) | On-Targetplus Non-targeting control pool | Dharmacon (Horizon Discovery, UK) | Cat#D-001810-10-05 | Transfected construct (human) as the negative control for RNAi experiment |
| Transfected construct (Homo sapiens) | siRNA to human CBS (SMARTpool) |
Dharmacon (Horizon Discovery, UK) | Cat#L-008617-00-0005 | Transfected construct (human) |
| Biological samples (Homo sapiens) | Tissue microarray slide contains 120 tumor sections and 63 normal sections from 62 individual gastric cancer patients | Wang et al., 2013 | These patients underwent gastrectomy from 2000 to 2005 in Changhai Hospital, second Military Medical University, Shanghai, China. All patients have not received any anticancer therapy before surgery | |
| Antibody | Anti-p53 (mouse monoclonal) | Santa Cruz | Cat#sc-126 | WB (1:1000) |
| Antibody | Anti-AKT (rabbit monoclonal) | Cell Signaling Technology | Cat#4691 | WB (1:1000) |
| Antibody | Anti-HA (mouse monoclonal) | In-house | Cat#12CA5 | WB (1:2000) |
| Antibody | Anti-Ras (mouse monoclonal) | Santa Cruz | Cat#sc-520 | WB (1:500) |
| Antibody | Anti-Cyclin A (mouse monoclonal) | Santa Cruz | Cat#sc-751 | WB (1:1000) |
| Antibody | Anti-Phospho-RB (S807/811) (rabbit monoclonal) | Cell Signaling Technology | Cat#8,561 | WB (1:1000) |
| Antibody | Anti-RB (mouse monoclonal) | BD Pharmingen | Cat#544136 | WB (1:1000) |
| Antibody | Anti-Phospho-AKT(S473) (rabbit monoclonal) | Cell Signaling Technology | Cat#4058 | WB (1:1000) |
| Antibody | Anti-p21(rabbit monoclonal) | Cell Signaling Technology | Cat#2947 | WB (1:1000) |
| Antibody | Anti-p16 (mouse monoclonal) | BD Pharmingen | Cat#550834 | WB (1:1000) |
| Antibody | Anti-CBS (rabbit monoclonal) | Proteintech | Cat#14787–1-AP | WB (1:1000), IF(1:100) |
| Antibody | Anti-PTEN (rabbit monoclonal) | Cell Signaling Technology | Cat#9559 | WB (1:1000) |
| Antibody | Anti-SLC7A11 (rabbit monoclonal) | Cell Signaling Technology | Cat#12691 | WB (1:1000) |
| Antibody | Anti-CTH (rabbit monoclonal) | Cell Signaling Technology | Cat#19689 | WB (1:1000) |
| Antibody | Anti-IL-1α (Goat polyclonal) | R&D Systems | Cat#AF-200-NA | WB (1:1000) |
| Antibody | Anti-IL-1β (mouse monoclonal) | R&D Systems | Cat#MAB201100 | WB (1:1000) |
| Antibody | Anti-IL-8 (mouse monoclonal) | R&D Systems | Cat#MAB208100 | WB (1:1000) |
| Antibody | Anti-IL-6 (goat polyclonal) | R&D Systems | Cat#AB-206-NA | WB (1:1000) |
| Antibody | Anti-OXPHOS (mouse monoclonal) | abcam | Cat#ab110413 | WB (1:1000) |
| Antibody | Anti-FLAG (mouse monoclonal) | Sigma-Aldrich | Cat#F3165 | WB (1:1000) |
| Antibody | Anti-β-Actin conjugated to HRP (mouse monoclonal) | Sigma-Aldrich | Cat#A3854 | WB (1:10,000) |
| Antibody | Anti-Vinculin conjugated to HRP (mouse monoclonal) | Santa Cruz | Cat# sc-73614HRP | WB (1:2000) |
| Antibody | Goat anti-rabbit IgG (H+L) HRP conjugate (goat polyclonal) | Bio-Rad Laboratories | Cat# 170-6515 | WB (1:2000) |
| Antibody | Goat anti-mouse IgG (H+L) HRP conjugate (goat polyclonal) | Bio-Rad Laboratories | Cat#172-1011 | WB (1:2000) |
| Sequence-based reagent | Human CBS-Forward | This paper | PCR primers | 5’-GGGGCTGAGATTGTGAGGAC-3’ |
| Sequence-based reagent | Human CBS-Reverse | This paper | PCR primers | 5’-CGGTACTGGTCTAGGATGTGA-3’ |
| Sequence-based reagent | Human CBS-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-CAGAGGATAAGGAAGCCAAG-3’ |
| Sequence-based reagent | Human CBS-Reverse | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TC CCAATCTTGTTGATTCTGAC-3’ |
| Sequence-based reagent | Human CBS methylated-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-CGAGATATTGGTCGGCGTC-3’ |
| Sequence-based reagent | Human CBS unmethylated-Forward | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TTATGAGATATTGGTTGGTGTT-3’ |
| Sequence-based reagent | Human CBS unmethylated-Reverse | Zhao et al., 2012 | Methylation-specific PCR primers | 5’-TACCCCAACTACAACAAAACA-3’ |
| Commercial assay or kit | Click-iT EdU AlexaFluor-488 imaging kit | Invitrogen | Cat#C10337 | |
| Commercial assay or kit | Qproteome mitochondria isolation kit | Qiagen | Cat#37612 | |
| Commercial assay or kit | ISOLATE-II kit | Bioline | Cat#52073 | |
| Commercial assay or kit | SuperScript III reverse transcriptase | Invitrogen | Cat#18080051 | |
| Commercial assay or kit | Fast SYBR green Master Mix | Applied Biosystems | Cat#4385612 | |
| Commercial assay or kit | NucleoSpin Tissue Kit | Macherey-Nagel | Cat#740952 | |
| Commercial assay or kit | EZ DNA methylation kit | Zymo Research | Cat#D5001 | |
| Commercial assay or kit | Glutathione Assay Kit | Cayman Chemical | Cat#703002 | |
| Chemical compound, drug | O-(Carboxymethyl)hydroxylamine hemihydrochloride (AOAA) | Sigma-Aldrich | Cat#C13408 | Final conc: 30 μM |
| Chemical compound, drug | Doxycycline hyclate | Sigma-Aldrich | Cat#D5207 | Final conc: 1 μg/ml |
| Chemical compound, drug | (Z)–4-hydroxytamoxifen (4-OHT) | Sigma-Aldrich | Cat#H7904 | Final conc: 20 nM |
| Chemical compound, drug | L-serine (3–13C) | Cambridge Isotope Laboratories | Cat#CLM-1572 | Final conc: 400 μM |
| Chemical compound, drug | NEM | Sigma-Aldrich | Cat#E3876 | Final conc: 50 mM |
| Chemical compound, drug | Ammonium formate | Sigma-Aldrich | Cat#516961 | Final conc: 10 mM |
| Chemical compound, drug | Erastin | Sigma-Aldrich | Cat#E7781 | Final conc: 5 μM |
| Chemical compound, drug | Protease K | Thermo Fisher | Cat#25530029 | Final conc: 0.1 μg/ml |
| Software, algorithm | GraphPad Prism | GraphPad Software | Version 9.3.0 | |
| Software, algorithm | Molecular signatures database | Broad Institute | Version 6.1 | |
| Software, algorithm | MetaboAnalyst | https://www.metaboanalyst.ca | Version 4.0 | |
| Other | DAPI stain | Invitrogen | Cat#D1306 | Final conc: 0.5–1 µg/ml |
| Other | MitoTracker Deep Red FM | Invitrogen | Cat#M22426 | Final conc: 1 μM |
| Other | MitoSOX red | Invitrogen | Cat#M36008 | Final conc: 5 μM |
| Other | 2′,7′-Dichlorofluorescein diacetate (H2DCFDH-DA) | Sigma-Aldrich | Cat#35845 | Final conc: 10 μM |
| Other | 7-Azido-4-Methylcoumarin (AzMC) | Sigma-Aldrich | Cat#802409 | Final conc: 20 μM |
| Other | 5-Ethyl-2’deoxyuridine (EdU) | Invitrogen | Cat#A10044 | Final conc: 10 μM |
| Other | X-gal | Sigma-Aldrich | Cat#B4252 | Final conc: 1 mg/ml |