TABLE 2.
Oligonucleotide probes used in this study
Probe | Specificity | Sequence (5′ to 3′) of probe | Target site (rRNA positions)a | % FA in situb | Reference |
---|---|---|---|---|---|
EUB338 | Bacteria | GCTGCCTCCCGTAGGAGT | 16S, 338–355 | 0–35 | 4 |
NON338 | ACTCCTACGGGAGGCAGC | 16S, 338–355 | 0–35 | 62 | |
HGC69a | Actinobacteria | TATAGTTACCACCGCCGT | 23S, 1901–1981 | 20 | 53 |
HGC236 | Actinobacteria | AACAAGCTGATAGGCCGC | 16S, 235–253 | 10 | 19 |
HGC664 | Actinobacteria | AGGAATTCCAGTCTCCCC | 16S, 663–681 | 30 | 19 |
HG1-840 | HG1 cluster of the class Actinobacteria | TCGCA(C/G)AAACCGTGGAAG | 16S, 840–846 | 10 | This study |
HG1-654 | HG1 cluster of the class Actinobacteria (without FukuN105, 1605-10, 1405-72, and 25-4-33); “cross-reaction” with some CFBc” | AGTCTCCCCTACCAAACTC | 16S, 654–672 | 35 | This study |
HGC270H | Helper for HGC236 | ACCCGTCG(T/A/C)(C/A)GCCTTGGT | 16S, 270–287 | 10 | This study |
HGC697H | Helper for HGC664 | GTTCCTCCTGATATCTGCGCA | 16S, 697–717 | 30 | This study |
HG1-810H | Helper for HGC840 | CTAG(C/T)GCCCA(C/T)CGTTTACGG | 16S, 810–829 | 10 | This study |
HG1-820H | Helper for HGC840 | GTTC(G/C)CACAACTAG(C/T)GCCCA | 16S, 820–839 | 10 | This study |
HG1-859H | Helper for HGC840 | GGGGC(G/A)CTTAATGCGTTAGCTG | 16S, 859–880 | 10 | This study |
E. coli numbering (11).
Percent formamide (FA) in in situ hybridization buffer.