Skip to main content
. 2022 Jun 14;3(6):100658. doi: 10.1016/j.xcrm.2022.100658
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Recombinant AMMO1 Snijder et al., 2018 N/A
Recombinant CL40 with human constant regions Singh et al., 2020 N/A
Recombinant CL59 with human constant regions Singh et al., 2020 N/A
Recombinant E1D1 with human constant regions This study N/A
hCD20- BV786 BD Biosciences Cat# 743611; RRID:AB_2741622
hCD45-FITC ThermoFisher Cat# 5010066; RRID:AB_1907394
mCD45-APC Biolegend Cat# 103112; RRID:AB_312977
hCD33-PE BD Biosciences Cat# 555450; RRID:AB_395843
hCD19- BV711 Biolegend Cat# 302246; RRID:AB_2562065
hCD4- AF700 ThermoFisher Cat# 56-0048-82; RRID:AB_657741
hCD8-BV421 BD Biosciences Cat# 562429; RRID:AB_11153676
mCD16/32 Biolegend Cat# 101302; RRID:AB_312801
Rabbit anti-His tag Sigma Aldrich Cat# SAB5600227
Goat anti-mouse IgG-HRP SouthernBiotech Cat# 1033–05; RRID:AB_2737432
Goat anti-human IgG-HRP SouthernBiotech Cat# 2010–05; RRID:AB_2795564
Goat anti-human IgG-HRP Jackson ImmunoResearch Cat# 115-035-008; RRID:AB_2313585
Goat anti-human IgG SouthernBiotech Cat# 1030–01; RRID:AB_2794290
Goat Anti-Mouse IgG, Human ads-HRP SouthernBiotech Cat# 1030–05; RRID:AB_2619742

Bacterial and virus strains

EBV B95.8/F Delecluse et al., 1998 N/A
EBV AKTA-GFP Molesworth et al., 2000 N/A

Biological samples

human CD34-enriched PBSCs Co-operative Center for Excellence in Hematology, Fred Hutchinson Cancer Research Center N/A

Chemicals, peptides, and recombinant proteins

Platinum Super-Fi II DNA polymerase ThermoFisher Cat# 12361010
In-fusion HD cloning kit Takara Bio Cat# 638920
Polybrene Millipore Sigma Cat# TR-1003-G
293Freestyle Media ThermoFisher Cat# 12338018
Phosphate Buffered Saline Corning Cat# 21-040-CM
Protein A Agarose GoldBio Cat# P-400-5
Pierce IgG Elution Buffer ThermoFisher Cat# 21004
Ni-NTA resin ThermoFisher Cat# 88221
Galanthus Nivalis Lectin Agarose Vector Laboratories Cat# AL-1243-5
disuccinimidyl suberate Thermofisher Cat# 21555
synthetic lipid A in squalene emulsion SLA-SE Infectious Disease Research Institute N/A
Sigma Adjuvant System Sigma Aldrich Cat# S6322
Pierce Protein A/G Binding Buffer ThermoFisher Cat# 54200
Pierce Protein A/G resin ThermoFisher Cat# 20422
GeneJuice Transfection Reagent Sigma Aldrich Cat# 70967
293-Free Transfection Reagent Millipore Sigma Cat# 72181
0.25% trypsin ThermoFisher Cat# 25200056
10% Formalin Millipore Sigma Cat# HT501128
eBioscience Fixable Viability Dye eFluor 506 ThermoFisher Cat# 65-0866-18
SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat# 5120–0081
EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat# 21330
Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat# 87766
NeutrAvidin Protein ThermoFisher Cat# 31000
Streptavidin Magnetic Beads New England BioLabs Cat #S1420S

Critical commercial assays

DNeasy Blood & Tissue Kit Qiagen Cat# 69504
2×QuantiTect Probe PCR Master Mix Qiagen Cat# 204343
Anti-Human Fc Capture (AHC) Biosensors Sartorius Cat# 18–5060
QuickChange XL II Kit Agilent Cat# 200521
TaqMan Copy Number Reference Assay, human, RNase P Thermofisher Cat# 4403326

Experimental models: cell lines

Raji ATCC CCL-86
293-6E cells National Research Council, Canada RRID:CVCL_HF20
293–2089 Delecluse et al., 1998 N/A
SVKCR2 Li et al., 1992b RRID:CVCL_YD67
293T RRID:CVCL_0063
AKATA-BX1-GFP Molesworth et al., 2000)

Experimental models: Organisms/strains

NOD-scid Il2rgnull mice The Jackson Laboratory Stock No: 005557

Oligonucleotides

Forward primer specific for EBV BALF5 gene:
CCCTGTTTATCCGATGGAATG
Kimura et al., 1999 N/A
Reverse primer specific for EBV BALF5 gene:
CGGAAGCCCTCTGGACTTC
Kimura et al., 1999 N/A
FAM-labeled probe specific for EBV BALF5 gene:
CGCATTTCTCGTGCGTGTACACC
Kimura et al., 1999 N/A

Recombinant DNA

BALF5 Target DNA for standard:
ACCGAGACCCGGCAGGGGGTCCTGCGGTC
GAAGGTGCTGGCCTTGAGGGCGCTGAGGA
CTGCAAACTCCACGTCCAGACCCTGAGGC
GCGCTGGCGTAGAAGTAGGCCTGCTGCCC
AAACACGTTCACACACACGCTGGCCCCAT
CGGCCTTGCGCCGGCCCAGTAGCTTGAT
GACGATGCCACATGGCACCACATACCCCT
GTTTATCCGATGGAATGACGGCGCATTTCT
CGTGCGTGTACACCGTCTCGAGTATGTCG
TAGACATGGAAGTCCAGAGGGCTTCCGTG
GGTGTCTGCCTCCGGCCTTGCCGTGCCCT
CTTGGGCACGCTGGCGCCACCACATGCCC
TTTCCATCCTCGTCACCCCCCACCACCGTC
AGGGAGTCTTGGTAGAAGCACAGGGGGGG
CTGAGGCCCCCGCACATCCACCACCCCTGC
GGCGCCTGGTGTCTGGAAACACTTGGGAAT
GAGACGCAGGTACTCCTTGTCAGGCTTTTTC
Singh et al., 2020 Custom Synthesis Integrated DNA technologies
p2670 Delecluse et al., 1998 N/A
p509 Neuhierl et al., 2002 N/A
pTT3-gH-HIS-AVI Snijder et al., 2018 N/A
pTT3-gL Snijder et al., 2018 N/A
pTT3-gH This Study N/A
pTT3-gH-K73W-Y76A This Study N/A
pTT3-gH-IMX313 This Study N/A
pTT3-gH-ferritin This Study N/A
pCVL-UCOE0.7-SFFV-muScn-IRES-GFP Bandaranayake et al., 2011 N/A
pCVL-UCOE0.7-SFFV-gH-C153T-IMX313-IRES-GFP This Study N/A
pCVL-UCOE0.7-SFFV-gH-ferritin-IRES-GFP This Study N/A
pCVL-UCOE0.7-SFFV-gH--C153T-I3-IRES-GFP This Study N/A
pCVL-UCOE0.7-SFFV-gH-C153T-cTRP(6)ss-IRES-GFP This Study N/A
pCVL-UCOE0.7-SFFV-muScn-IRES-RFP Bandaranayake et al., 2011 N/A
pCVL-UCOE0.7-SFFV-gL-IRES-RFP This Study N/A
psPAX2 Addgene #12260
pMD2.G Addgene #12259

Software and algorithms

QuantaSoft™ Analysis Software Bio-Rad N/A
Prism 9.2.0 or later software package Graph Pad Software N/A
Leginon Suloway et al., 2005 N/A
cryoSPARC Punjani et al., 2017 N/A
CTFFIND Rohou and Grigorieff, 2015 N/A
Appion Lander et al., 2009 N/A
CTFFIND4 Mindell and Grigorieff, 2003 N/A
DoG picker Voss et al., 2009 N/A
EMAN 1.9 Ludtke et al., 1999 N/A
RELION/2.1 Kimanius et al., 2016; Scheres, 2012a; N/A
CryoSPARC Punjani et al., 2017 N/A
CTFFIND4 Mindell and Grigorieff, 2003 N/A
ChimeraX Pettersen et al., 2021 N/A
EPU ThermoFisher N/A
ASTRA Wyatt Technologies N/A

Other

QuantStudio 7 Flex Real-Time PCR System Applied Biosystems N/A
HiLoad 16/600 Superdex 200 pg Millipore Sigma Cat# GE28-9893-35
Superose 6 Increase 10/300 G Millipore Sigma Cat# GE29-0915-96
Hi-Trap Q HP Millipore Sigma Cat# GE29-0513-25
C1000 Touch Thermal Cycler Bio-Rad N/A
NGC FPLC Bio-Rad N/A
SpectraMax M2 plate reader Molecular Devices N/A
BD LSRII cytometer BD Biosciences N/A
Guava HT cytometer Luminex N/A
Octet Red 96E Sartorius N/A
1260 High-Performance Liquid Chromatography System Agilent N/A
Heleos multi-angle light scattering detector Wyatt Technology N/A
tREX refractive index detector Wyatt Technology N/A