REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies | ||
Recombinant AMMO1 | Snijder et al., 2018 | N/A |
Recombinant CL40 with human constant regions | Singh et al., 2020 | N/A |
Recombinant CL59 with human constant regions | Singh et al., 2020 | N/A |
Recombinant E1D1 with human constant regions | This study | N/A |
hCD20- BV786 | BD Biosciences | Cat# 743611; RRID:AB_2741622 |
hCD45-FITC | ThermoFisher | Cat# 5010066; RRID:AB_1907394 |
mCD45-APC | Biolegend | Cat# 103112; RRID:AB_312977 |
hCD33-PE | BD Biosciences | Cat# 555450; RRID:AB_395843 |
hCD19- BV711 | Biolegend | Cat# 302246; RRID:AB_2562065 |
hCD4- AF700 | ThermoFisher | Cat# 56-0048-82; RRID:AB_657741 |
hCD8-BV421 | BD Biosciences | Cat# 562429; RRID:AB_11153676 |
mCD16/32 | Biolegend | Cat# 101302; RRID:AB_312801 |
Rabbit anti-His tag | Sigma Aldrich | Cat# SAB5600227 |
Goat anti-mouse IgG-HRP | SouthernBiotech | Cat# 1033–05; RRID:AB_2737432 |
Goat anti-human IgG-HRP | SouthernBiotech | Cat# 2010–05; RRID:AB_2795564 |
Goat anti-human IgG-HRP | Jackson ImmunoResearch | Cat# 115-035-008; RRID:AB_2313585 |
Goat anti-human IgG | SouthernBiotech | Cat# 1030–01; RRID:AB_2794290 |
Goat Anti-Mouse IgG, Human ads-HRP | SouthernBiotech | Cat# 1030–05; RRID:AB_2619742 |
Bacterial and virus strains | ||
EBV B95.8/F | Delecluse et al., 1998 | N/A |
EBV AKTA-GFP | Molesworth et al., 2000 | N/A |
Biological samples | ||
human CD34-enriched PBSCs | Co-operative Center for Excellence in Hematology, Fred Hutchinson Cancer Research Center | N/A |
Chemicals, peptides, and recombinant proteins | ||
Platinum Super-Fi II DNA polymerase | ThermoFisher | Cat# 12361010 |
In-fusion HD cloning kit | Takara Bio | Cat# 638920 |
Polybrene | Millipore Sigma | Cat# TR-1003-G |
293Freestyle Media | ThermoFisher | Cat# 12338018 |
Phosphate Buffered Saline | Corning | Cat# 21-040-CM |
Protein A Agarose | GoldBio | Cat# P-400-5 |
Pierce IgG Elution Buffer | ThermoFisher | Cat# 21004 |
Ni-NTA resin | ThermoFisher | Cat# 88221 |
Galanthus Nivalis Lectin Agarose | Vector Laboratories | Cat# AL-1243-5 |
disuccinimidyl suberate | Thermofisher | Cat# 21555 |
synthetic lipid A in squalene emulsion SLA-SE | Infectious Disease Research Institute | N/A |
Sigma Adjuvant System | Sigma Aldrich | Cat# S6322 |
Pierce Protein A/G Binding Buffer | ThermoFisher | Cat# 54200 |
Pierce Protein A/G resin | ThermoFisher | Cat# 20422 |
GeneJuice Transfection Reagent | Sigma Aldrich | Cat# 70967 |
293-Free Transfection Reagent | Millipore Sigma | Cat# 72181 |
0.25% trypsin | ThermoFisher | Cat# 25200056 |
10% Formalin | Millipore Sigma | Cat# HT501128 |
eBioscience Fixable Viability Dye eFluor 506 | ThermoFisher | Cat# 65-0866-18 |
SureBlue Reserve TMB Microwell Peroxidase substrate | SeraCare | Cat# 5120–0081 |
EZ-Link NHS-PEG4-Biotin Kit | ThermoFisher | Cat# 21330 |
Zeba Spin Desalting Columns 40K MWCO | ThermoFisher | Cat# 87766 |
NeutrAvidin Protein | ThermoFisher | Cat# 31000 |
Streptavidin Magnetic Beads | New England BioLabs | Cat #S1420S |
Critical commercial assays | ||
DNeasy Blood & Tissue Kit | Qiagen | Cat# 69504 |
2×QuantiTect Probe PCR Master Mix | Qiagen | Cat# 204343 |
Anti-Human Fc Capture (AHC) Biosensors | Sartorius | Cat# 18–5060 |
QuickChange XL II Kit | Agilent | Cat# 200521 |
TaqMan Copy Number Reference Assay, human, RNase P | Thermofisher | Cat# 4403326 |
Experimental models: cell lines | ||
Raji | ATCC | CCL-86 |
293-6E cells | National Research Council, Canada | RRID:CVCL_HF20 |
293–2089 | Delecluse et al., 1998 | N/A |
SVKCR2 | Li et al., 1992b | RRID:CVCL_YD67 |
293T | RRID:CVCL_0063 | |
AKATA-BX1-GFP | Molesworth et al., 2000) | |
Experimental models: Organisms/strains | ||
NOD-scid Il2rgnull mice | The Jackson Laboratory | Stock No: 005557 |
Oligonucleotides | ||
Forward primer specific for EBV BALF5 gene: CCCTGTTTATCCGATGGAATG |
Kimura et al., 1999 | N/A |
Reverse primer specific for EBV BALF5 gene: CGGAAGCCCTCTGGACTTC |
Kimura et al., 1999 | N/A |
FAM-labeled probe specific for EBV BALF5 gene: CGCATTTCTCGTGCGTGTACACC |
Kimura et al., 1999 | N/A |
Recombinant DNA | ||
BALF5 Target DNA for standard: ACCGAGACCCGGCAGGGGGTCCTGCGGTC GAAGGTGCTGGCCTTGAGGGCGCTGAGGA CTGCAAACTCCACGTCCAGACCCTGAGGC GCGCTGGCGTAGAAGTAGGCCTGCTGCCC AAACACGTTCACACACACGCTGGCCCCAT CGGCCTTGCGCCGGCCCAGTAGCTTGAT GACGATGCCACATGGCACCACATACCCCT GTTTATCCGATGGAATGACGGCGCATTTCT CGTGCGTGTACACCGTCTCGAGTATGTCG TAGACATGGAAGTCCAGAGGGCTTCCGTG GGTGTCTGCCTCCGGCCTTGCCGTGCCCT CTTGGGCACGCTGGCGCCACCACATGCCC TTTCCATCCTCGTCACCCCCCACCACCGTC AGGGAGTCTTGGTAGAAGCACAGGGGGGG CTGAGGCCCCCGCACATCCACCACCCCTGC GGCGCCTGGTGTCTGGAAACACTTGGGAAT GAGACGCAGGTACTCCTTGTCAGGCTTTTTC |
Singh et al., 2020 | Custom Synthesis Integrated DNA technologies |
p2670 | Delecluse et al., 1998 | N/A |
p509 | Neuhierl et al., 2002 | N/A |
pTT3-gH-HIS-AVI | Snijder et al., 2018 | N/A |
pTT3-gL | Snijder et al., 2018 | N/A |
pTT3-gH | This Study | N/A |
pTT3-gH-K73W-Y76A | This Study | N/A |
pTT3-gH-IMX313 | This Study | N/A |
pTT3-gH-ferritin | This Study | N/A |
pCVL-UCOE0.7-SFFV-muScn-IRES-GFP | Bandaranayake et al., 2011 | N/A |
pCVL-UCOE0.7-SFFV-gH-C153T-IMX313-IRES-GFP | This Study | N/A |
pCVL-UCOE0.7-SFFV-gH-ferritin-IRES-GFP | This Study | N/A |
pCVL-UCOE0.7-SFFV-gH--C153T-I3-IRES-GFP | This Study | N/A |
pCVL-UCOE0.7-SFFV-gH-C153T-cTRP(6)ss-IRES-GFP | This Study | N/A |
pCVL-UCOE0.7-SFFV-muScn-IRES-RFP | Bandaranayake et al., 2011 | N/A |
pCVL-UCOE0.7-SFFV-gL-IRES-RFP | This Study | N/A |
psPAX2 | Addgene | #12260 |
pMD2.G | Addgene | #12259 |
Software and algorithms | ||
QuantaSoft™ Analysis Software | Bio-Rad | N/A |
Prism 9.2.0 or later software package | Graph Pad Software | N/A |
Leginon | Suloway et al., 2005 | N/A |
cryoSPARC | Punjani et al., 2017 | N/A |
CTFFIND | Rohou and Grigorieff, 2015 | N/A |
Appion | Lander et al., 2009 | N/A |
CTFFIND4 | Mindell and Grigorieff, 2003 | N/A |
DoG picker | Voss et al., 2009 | N/A |
EMAN 1.9 | Ludtke et al., 1999 | N/A |
RELION/2.1 | Kimanius et al., 2016; Scheres, 2012a; | N/A |
CryoSPARC | Punjani et al., 2017 | N/A |
CTFFIND4 | Mindell and Grigorieff, 2003 | N/A |
ChimeraX | Pettersen et al., 2021 | N/A |
EPU | ThermoFisher | N/A |
ASTRA | Wyatt Technologies | N/A |
Other | ||
QuantStudio 7 Flex Real-Time PCR System | Applied Biosystems | N/A |
HiLoad 16/600 Superdex 200 pg | Millipore Sigma | Cat# GE28-9893-35 |
Superose 6 Increase 10/300 G | Millipore Sigma | Cat# GE29-0915-96 |
Hi-Trap Q HP | Millipore Sigma | Cat# GE29-0513-25 |
C1000 Touch Thermal Cycler | Bio-Rad | N/A |
NGC FPLC | Bio-Rad | N/A |
SpectraMax M2 plate reader | Molecular Devices | N/A |
BD LSRII cytometer | BD Biosciences | N/A |
Guava HT cytometer | Luminex | N/A |
Octet Red 96E | Sartorius | N/A |
1260 High-Performance Liquid Chromatography System | Agilent | N/A |
Heleos multi-angle light scattering detector | Wyatt Technology | N/A |
tREX refractive index detector | Wyatt Technology | N/A |