Abstract
While SARS-CoV-2 vaccines have demonstrated strong immunogenicity and protection, concerns about the duration and breadth of these responses remain. In this study, we show that co-delivery of plasmid-encoded adenosine deaminase-1 (pADA) with SARS-CoV-2 spike DNA antigens (pS), enhances immune memory and durability in vivo. Co-immunized mice displayed increased spike-specific IgG of higher affinity and neutralizing capacity as compared to pS-only immunized animals. Importantly, pADA significantly improved the longevity of these enhanced responses in vivo. This coincided with durable increases in frequencies of plasmablasts, receptor binding domain (RBD)-specific memory B cells, and SARS-CoV-2 specific T follicular helper cells. Increased spike-specific T cell polyfunctionality was also observed. Notably, animals co-immunized with pADA had significantly reduced viral loads compared to their non-adjuvanted counterparts in a SARS-CoV-2 infection model. These data suggest that pADA enhances immune memory and durability and supports further translational studies.
Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected over 200 million people and caused over 4 million deaths1. SARS-CoV-2 vaccines have demonstrated acute immunogenicity and protection. However, studies demonstrating decline in humoral responses post vaccination and infection, as well as the emergence of variants of concern (VOC) against which current vaccines may be less effective2, necessitate the continued study of vaccine modalities which promote robust, broad, and durable immunity. Recent studies evaluating the durability of SARS-CoV-2 mRNA vaccines, mRNA-12733 and Comirnaty4, showed significant reductions in neutralizing antibodies, particularly against VOCs B.1.351 and P.1, at 3–6months post vaccination. An additional study in rhesus macaques demonstrated proof-of-concept findings that neutralizing antibodies are sufficient for SARS-CoV-2 protection and CD8+ T cell responses contribute to protection when neutralizing antibody titers decline5. Thus, vaccine formulations which can provide both long lasting antibody and T cell responses may prove particularly effective and durable.
Adenosine deaminase 1 (ADA-1) has immune enhancement functions that have the potential to improve SARS-CoV-2 vaccine efficacy. The enzymatic function of ADA-1 is to catalyze the irreversible deamination of adenosine into inosine thus regulating intracellular and extracellular levels of adenosine. Among heritable severe-combined immunodeficiencies (SCID) in humans, approximately 15% are caused by mutation in the ADA1 gene and pegylated ADA is used therapeutically as a SCID treatment. We and others have previously shown that ADA-1 is an important immune modulator6,7, 8. During immune synapse formation between dendritic cells and T cells, ADA-1 can interact with receptors on immune cells both to mediate effective co-stimulatory signals and to promote T cell proliferation and differentiation6, 7. We have recently demonstrated a novel property of ADA-1, wherein it improves the function and differentiation of the T follicular helper cell (TFH) program as measured by the ability to provide B cell help in vitro6. We extended these studies and further showed that co-immunization of plasmid-encoded ADA-1 (pADA) in the context of an HIV DNA vaccine enhances germinal center formation, TFH function, and antibody magnitude and quality in vivo9.
A previous study demonstrated two immunizations of synthetic DNA (synDNA) vaccines encoding the full-length SARS-CoV-2 spike glycoproteins (pS) induced robust humoral and cellular immunity in mice and protected 100% of mice from SARS-CoV-2 replication in an adeno-associated virus-6.2FF human angiotensin converting enzyme-2 (AAV6.2FF-hACE2) transduced mouse model of SARS-CoV-2 infection10. In this report, we demonstrated that co-delivery of pADA with pS would improve spike specific humoral and cellular responses durability and quality following only one immunization. Compared to pS only, mice co-immunized with pS and pADA mice exhibited increased concentrations of spike-specific IgG which bound with increased affinity and exhibited increased neutralization capability. Increased frequencies of plasmablasts, receptor binding domain (RBD)-specific memory B cells, and TFH cells were also observed in co-immunized mice. Spike-specific T cell polyfunctionality was also enhanced in co-immunized mice. Here, single pADA co-immunization protected 100% of challenged mice from viral replication in the lung as measured by TCID50 compared to only 40% of mice receiving a single immunization of pS alone. Importantly, at >400 days post final immunization, viral loads were completely reduced in pADA co-immunized animals compared to those in the absence of pADA. These data suggest that pADA enhances the magnitude, quality, and duration of antigen-specific responses and supports continued study of this novel adjuvant molecule for SARS-CoV-2 vaccine advancement.
Methods
Plasmids and immunizations.
Codon-optimized DNA plasmids encoding full-length SARS-CoV-2 spike glycoproteins were produced commercially and subcloned into the pVax expression vector with an IgE leader sequence to facilitate in vivo secretion. Similarly, a synDNA construct encoding murine ADA-1 was generated in the pVax vector with an IgE leader sequence and commercially produced (Genscript, Piscataway, NJ) as previously described9. In vitro studies revealed the expression of the spike and ADA proteins after transfection of cell lines with the vaccine constructs as previously described 9, 19. Female BALB/c mice aged 6–8 weeks were immunized in the left tibialis anterior muscle with 30–50μL of the formulated vaccines. Vaccines included 10μg of pS alone or, 10ug of pS co-formulated with 10μg of pADA. Control mice remained unvaccinated or were immunized with 20ug of empty plasmid vector (pVax) to ensure an equal amount of DNA was administered across experimental groups. Male and female C57BL/6 mice at age 6–8 weeks were also immunized in the left tibialis anterior muscle with 30μL of the formulated vaccines. Immediately following vaccine injection, in vivo electroporation was performed using the CELLECTRA device (Inovio Pharmaceuticals, Bluebell, PA). Animals were housed in a temperature-controlled, light-cycled, specific-pathogen-free facility at Drexel University College of Medicine or Wistar Institute.
Ethical statement:
In vivo electroporation of DNA vaccines in mice was conducted in accordance with the guidelines set forth by the National Institutes of Health and performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) and Environmental Biosafety Committee approved protocols at Drexel University College of Medicine and Wistar Institute.
Mouse sacrifice, sample collection and tissue harvest.
At the time points shown in the in vivo study design, mice were either bled via cheek bleed or sacrificed. At sacrifice, blood, spleens, popliteal and inguinal lymph nodes were collected. Blood collected via cardiac puncture was collected into minicollect serum gel tubes (Grenier-Bio) and centrifuged at 13,000 RPM for 10 min at 4°C to separate serum. Spleens and lymph nodes were processed into single cell suspensions. Cells within the suspension were washed and resuspended in RPMI medium supplemented with 1% pen/strep and 10% FBS. Cell concentrations and viabilities were determined using a Countess Automated Cell Counter (Invitrogen, Life Technologies).
ELISA assays.
ELISA was used to determine RBD and S1 specific IgG present in mouse serum. Mouse blood samples were collected via cheek bleed or cardiac puncture. Enzyme immunoassay/radioimmunoassay (EIA/RIA) plates (Corning) were coated with 100μL per well of recombinant RBD or S1 (Sino Biologicals) that was diluted in PBS to a concentration of 0.5μg/mL. Plates were incubated overnight at 4°C. Plates were blocked using 3% BSA in 1× PBS for 2–4hrs at room temperature. Mouse serum was diluted in PBS with 1% BSA, added in duplicate and incubated overnight at 4°C. Plates were washed three times using PBS with 0.1% tween. HRP conjugated goat anti-mouse IgG (KPL or Columbia Biosciences) secondary antibody was added to plates. Plates were washed three times using PBS with 0.1% tween and were developed using TMB Ultra substrate (Thermo Fisher) according to the manufacturer’s instructions. The concentration of RBD and S1 specific IgG present in the sera was calculated by interpolating the optical densities on calibration curves which were generated with known quantities of mouse IgG (Thomas Scientific).
Surface Plasmon Resonance Assays.
SPR experiments were performed on a Biacore S200 biosensor (Global Cytiva Lifesciences) at 25 °C using PBS-P (10 mM Phosphate, 150 mM NaCl, pH 7.4, 0.05% P-20) as the running buffer. A CM5 sensor chip (Cytiva, Marlborough, MA) was docked and derivatized by amine coupling with RBD using freshly prepared 100 mM NHS (N-hydroxysuccinamide) and 400 mM EDC (1-ethyl-3-(3-(dimethylamino) propyl) carbodiimide) reagents (Cytiva) mixed 1:1. Flow cell 1 was activated and blocked and remained as the control of binding to RBD (Purified Wuhan recombinant Spike RBD, Sino Biological, BDA, Beijing, RBD-His 40592-VNAH, FC2). RBD directly coupled to the sensor was validated using ACE2 (10108-H08H) and VHH-72-huFc, the latter a generous gift from Integral Molecular (Philadelphia, PA). The anti-RBD titration standard was an RBD-specific neutralizing mouse monoclonal antibody (Mab) (40592-MM57). Serum from post-immunization bleeds were diluted in sample buffer with 20 mg/mL CM-Dextran saline, or NSB reducer (Cytiva) to minimize non-specific binding. The final serum sample dilutions were 1/15 and 1/20 (1.3-fold apart) in naïve serum. Sample matching naïve sera mixed with CM-Dextran in equal proportion, were used as negative controls, while Mab standards between 1.2 to 250 nM were also spiked in naïve serum mixed CM-Dextran were prepare. A surface density of 50 RU/KDa RBD was experimentally found to offer partial mass transport limited (MTL) binding of serum-spiked antibody standards injected over control and RBD flow cells at 5μL/min. Under MTL, the antibody binding rates are dependent on the concentration of RBD specific antibody binding. The anti-RBD Mab standard was used to calculate antibody concentrations of individual mouse sera. Duplicates of the Mab standards, controls and serum samples were injected over all surfaces for 1-minute (association phase) at flow 5 μL/min and washed with running buffer for 5 minutes (dissociation phase). The remaining bound antibodies were removed with two 40-second pulses of 15 mM HCl (pH 2.0). Polyclonal antibody (pAb) initial rates of binding were translated into concentrations using Phenom, a software developed to systematize multiple data analysis. Anti-RBD MAb standards against each domain at four concentrations spanning 1.2 to 250 nM were subsequently injected in a kinetic format at flow 50 μL/min for one minute to measure the kinetic profiles to each coupled domain.
To calculate the kinetics of pAb binding to RBD, two individual sera dilutions were injected in duplicate over all surfaces at flow 50 μL/min for one minute and bound pAb were washed with running buffer for 5 minutes followed by surface regeneration. All binding profiles (sensorgrams) were double referenced to minimize the impact of instrument and solvent noise. Raw data analysis for the calculation of binding rates and kinetics was blinded to sample identity. Two types of calculations were carried out to fully characterize individual sera: pAb epitope specific concentration (dR/dt=kt*C) and binding kinetics (dR/dt= ka*C*(Rmax-R)- kd*R), where Rmax and R were measured in RU (response units), C was the antibody concentration, kt was the mass transport constant, ka and kd were the kinetic association and dissociation constants. Specific pAb concentrations were calculated using Phenom v0.7.202101-alpha (Meritoki). Standard Mab binding profiles were globally fit to a 1:1 binding model to calculate the kinetic constants ka and kd and maximum binding capacity for each domain surface (or Rmax) using Scrubber 2.c (BioLogic Software, AU). In the same way, the profiles of pAb binding to RBD were analyzed by fixing the Rmax to the previously determined binding capacity for the RBD surface. The average kinetic parameters generated from two independent datasets (1/15 and 1/20 dilutions) were identical and were used to calculate the equilibrium association constants KA (ka/kd) M−1.
TFH activation-induced marker (AIM) assay.
Splenocytes from vaccinated mice were cultured at 37°C with 5% CO2 for 24 hours in the presence of 5 SARS-CoV-2 specific peptide pools [5 ug/mL final concentration] in 96-wells U bottom plates at 1×106 PBMC per well. A stimulation with an equal percentage amount of DMSO was performed as a negative control while Concanavalin A (0.5 ug/mL final concentration) (eBioscience, Cat: 00–4978-93) was included as a positive control. Supernatants were harvested at 24 hours post-stimulation for various assays. Cells were washed and incubated with fluorochrome-conjugated antibodies for at least 15–20 min at 4 °C or on ice, protected from light. Precision count beads from Biolegend (Cat: 424902) were used to calculate absolute number of cells. The following fluorochrome-conjugated anti-mouse antibodies were used: CD3 (Clone: 17A2, Cat: 100216), CD4 (Clone: GK1.5; Cat: 100414), CD25 (Clone: PC61; Cat: 102010), OX40 (Clone: OX-86; Cat: 119411), PD-L1 (Clone: 10F.9G2; Cat: 124321), PD-1 (Clone: RMP1–30; Cat: 109110) were all from BioLegend. CXCR5 (Clone: 2G8; Cat: 560615) and 41BB (Clone: 1AH2; Cat: 558976) were from BD. LIVE/DEAD Fixable Dead Cell Stain (Life Technologies) (Cat: L34957) was used to gate on live cells. Samples were acquired on a BD LSR II and data were analyzed using FlowJo software (Treestar).
Memory RBD-specific B cell Flow Cytometry.
Single cell suspensions of splenocytes from vaccinated mice were polyclonally stimulated for expansion of memory B cells in 96-well U bottom plates with 1ug/ml CLO97 and 10ng/ml rmIL-2 (Mabtech, Inc., Cat: 3825–2A) for 72 hours at 37°C, 5% CO2. Following 72 hours of polyclonal stimulation, splenocytes from vaccinated mice were washed and then incubated in 5ug/mL biotinylated RBD protein (Sino Biologicals, 40592-V08H-B) for 1 hr at room temperature (RT). After incubation, cells are washed and stained with APC-streptavidin (Cat: 405207) and PE-streptavidin (Cat: 405204) for 30 min at RT. Cells are washed and incubated with fluorochrome-conjugated antibodies for at least 15–20 min at 4 °C or on ice, protected from light. The following fluorochrome-conjugated anti-mouse antibodies were used: CD3 (Clone: 17A2, Cat: 100216), CD19 (Clone: 6D5; Cat: 115530), GL-7 (Clone: GL7; Cat: 144610), CD38 (Clone: 2H7; Cat: 102732), CD95 (Clone: SA367H8; Cat: 152612), B220 (Clone: RA3–6B2; Cat: 103241), IgD (Clone: 11–26c.2a; Cat: 405742), CD138 (Clone: 281–2; Cat: 142514), were all from Biolegend. LIVE/DEAD Fixable Dead Cell Stain (Life Technologies) (Cat. Number: L34957) was used to gate on live cells. Samples were acquired on a BD LSR II and data were analyzed using FlowJo software (Treestar).
T cell Flow Cytometry.
Single cell suspensions of splenocytes from vaccinated mice were cultured for 6 hours in the presence of five SARS-CoV-2 spike peptide pools [5 ug/mL final concentration] or in a 1× working dilution of Cell Activation Cocktail (BioLegend) (Cat: 423301) in 96-well V bottom plates at a concentration of 106 cells per well. As a negative control, cells were treated with an equal percentage amount of DMSO. All samples were also treated with a 1× working dilution of Protein Transport Inhibitor (eBioscience) (Cat: 00–4980-93) for the duration of the 6-hour stimulation. Following stimulation, cells were stained with the live/dead Fixable Aqua Dead Cell Kit (Invitrogen) (dilution 1/100; Cat: L34957) to gate on live cells and anti-mouse CD16/32 antibody (BioLegend) (Clone: 93; Cat: 101319). Cells were then stained at 4°C for 30 minutes with the following fluorochrome-conjugated anti-mouse antibodies: CD107α (Clone: 1D4B; Cat: 121606; Dilution: 1/400), CD4 (Clone: GK1.5; Cat: 100438; Dilution: 1/200), CD8 (Clone: 53–6.7; Cat: 100714; Dilution: 1/200), CD127 (Clone: SB/199; Cat: 121113; Dilution: 1/100), CD44 (Clone: 1M7, Cat: 103026; Dilution: 1/100), IL-4 (Clone: 11B11; Cat: 504133; Dilution: 1/100), IL-2 (Clone: JES6–5H4; Cat: 503832; Dilution: 1/100), IFN-γ (Clone: XMG1.2; Cat: 505810; Dilution: 1/100), TNF-α (Clone: MP6-XT22), CD3 (Clone: 145.2C11; Cat: 100310; Dilution: 1/100). All cytometric analyses were performed using an LSR II flow cytometer (BD), and data were analyzed using FlowJo software (Treestar).
Pseudovirus neutralization assay.
SARS-CoV-2 pseudovirus were produced using HEK293T cells transfected with 1:1 ratio of IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4–3.Luc.R-E- plasmid (NIH AIDS reagent) using Gene jammer (Agilent) as transfection reagent. Forty-eight hours post transfection, transfection supernatant was collected, enriched with FBS to 12% final volume, and stored at −80°C. SARS-Cov-2 pseudovirus neutralization assay was set up using D10 media (DMEM supplemented with 10%FBS and 1X Penicillin-Streptomycin) in a 96 well format using huCHOAce2 cells (Creative Biolabs, Cat: VCeL-Wyb019). For neutralization assay, 10,000 CHO-ACE2 cells were plated in 96-well plates and rested overnight at 37°C and 5% CO2 for 24 hours. Following day, sera from vaccinated and control groups were heat inactivated and serially diluted as desired. Sera were incubated with a fixed amount of SARS-Cov-2 pseudovirus for 90 minutes at RT following which the mix was added to huCHOAce2 cells and allowed to incubate in a standard incubator (37% humidity, 5% CO2) for 72h. Post 72h, cells were lysed using britelite plus luminescence reporter gene assay system (Perkin Elmer Cat: 6066769) and RLU were measured using the Biotek plate reader. Neutralization titers (ID50) were calculated using GraphPad Prism 8 and defined as the reciprocal serum dilution at which RLU were reduced by 50% compared to RLU in virus control wells after subtraction of background RLU in cell control wells.
Generation of AAV6.2FF-hACE2.
AAV6.2FF-hACE2 viruses were generated as previously described20. AAV vector titers were determined by quantitative polymerase chain reaction (qPCR) analysis as described elsewhere21.
SARS-CoV-2 challenge.
For challenge with SARS-CoV-2, all mice were anaesthetized with inhalation isoflurane. Mice were administered 1011 vector genomes of either AAV6.2FF-Luc or AAV6.2FF-hACE2 intranasally in 50μL (25μL per nare). For SARS-CoV-2 infection on day14 post-AAV infection, virus (SARS-CoV-2; hCoV-19/Canada/ON-VIDO-01/2020, GISAID accession#EPI_ISL_425177 https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSM4880052) was diluted in media and animals were administered 105 TCID50 intranasally in 50μL (25μL per nare). Animals were recovered and then weighed and monitored daily for any clinical signs of disease. On day 4 post-infection, animals were euthanized to examine viral replication in the respiratory tract. Euthanasia was performed by anesthesia with inhaled isoflurane followed by cervical dislocation.
Detection of SARS-CoV-2 in tissues.
For measurement of viral titers in the lungs of infected mice, TCID50 assays were performed. Following necropsy, tissue samples were frozen at −80°C. Tissue samples were thawed and placed in MEM, supplemented with 1× L-glutamine and 1% FBS and homogenized with 5 mm stainless steel beads in a Bead Ruptor Elite Tissue Homogenizer (Omni). Homogenates were clarified by centrifugation at 1500 × g for 10 minutes and ten-fold serial dilutions of tissue homogenates were made in MEM. Dilutions were added to 90–100% confluent Vero cells in triplicate wells and cytopathic effect was read at 5 dpi. TCID50 values per gram of tissue were calculated using the Reed and Muench method.
For detection of viral RNA, tissues collected were stored in RNAlater. RNA was extracted using an RNeasy mini plus kit (Qiagen), according to manufacturer’s instructions. RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems) and primers specific for the E gene of SARS-CoV-2, as per the diagnostic protocol recommended by the World Health Organization (Forward – ACAGGTACGTTAATAGTTAATAGCGT; Reverse –ATATTGCAGCAGTACGCACACA; Probe–FAM-ACACTAGCCATCCTTACTGCGCTTCGBBQ). Oligonucleotide concentrations were 400nM for the primers and 200nM for the probe. RT-qPCR stages were as follows: UNG incubation (25°C for 2 minutes), reverse transcription (53°C for 10 minutes), polymerase activation (95°C for 2 minutes), followed by amplification (40 cycles of 95°C for 3 seconds and 60 °C for 30 seconds).
Statistical analysis.
All statistics were analyzed using GraphPad Prism 9. Error bars represent means ± SEM or the mean± SD where denoted. Normality was determined using the Shapiro-Wilk normality test. Outliers were determined and removed using the ROUT algorithm. For data deemed normal, ordinary one-way analysis of variance (ANOVA) was performed to determine statistical significance between groups of three or more (Tukey’s multiple comparison test). For data deemed non-normal, a non-parametric Kruskal-Wallis test was performed in order to determine statistical differences between groups of three or more. Statistical differences between groups of two were determined via unpaired t test for data deemed normal, or Mann-Whitney U test for data deemed non-normal. In all data *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001.
AUC analysis.
For each mouse: area under the curve (AUC) was determined for RBD IgG from days 35, 56, 84 and 127 post immunization using R package bayestestRR package. Outliers were identified by the ROUT method on Graphpad Prism and removed prior to AUC calculation. Statistical significances (p-value <0.05) between different experimental group AUC values were determined by non-parametric (Wilcoxon) test using ggpubr R package.
Results
pADA co-immunization promotes robust and durable SARS-CoV-2 specific humoral immunity in vivo.
To evaluate immune durability and memory following vaccination, 6–8week old female BALB/c (Fig. 1) or 6–8week old male and female C57BL/6 mice (Supplemental Figure 2) were immunized once with a DNA vaccine construct expressing the full-length SARS-CoV-2 Spike protein (pS) alone, or in combination with a DNA plasmid expressing murine adenosine deaminase-1 (pADA). Control mice remained unvaccinated (Fig. 1) or received an empty plasmid vector (pVax) (Supplemental Figure 2). All mice received a total of 20μg of plasmid DNA to control for any non-specific DNA induced innate responses. Mice were bled longitudinally post immunization and serum was used to evaluate antibody (Ab) levels, function, affinity, and durability. Figures 1b and 1c depicts anti-S1 and anti-RBD Ab levels, respectively, as determined by ELISA. Co-immunization with pADA significantly improved the magnitude of Ab levels at multiple time points post vaccination and elicited a robust durable Ab response. In two independent experiments, ADA-1 co-immunized mice showed peak Ab responses at between days 21–56 post immunization (data for day 21 not shown). Specifically, ADA-1 improved the anti-S1 Ab response at day 35 post vaccination, but importantly, ADA-1 significantly (p=0.0079) elicited a durable response up to 127 days when compared to those mice which did not receive ADA-1 (Fig.1b). Similarly, co-immunization with ADA-1 elicited significant increase in RBD-specific IgG in co-immunized mice at days 35 (p=0.0016) and 56 (p=0.0002) compared to PS-only immunized mice. A trend of increased RBD IgG was exhibited in co-immunized mice at day 127 (Fig. 1c). To account for the impact of ADA-1 on multiple time points post vaccination, we measured Area Under the Curve (AUC) in mice immunized in the presence and absence of ADA-1. We showed that ADA-1 elicited a significantly higher response in S1 IgG (p=0.016) (Fig. 1d) and RBD IgG (p= 0.0079) (Fig. 1e) when compared to Ab elicited in the absence of ADA-1. This confirms the ability of ADA-1 to elicit a strong Ab response over multiple time points. Collectively, these data suggest that pADA-adjuvanted responses are robust and durable in vivo.
Figure 1. Co-immunization with pADA enhances SARS-COV-2 humoral responses.
Female BALB/c mice at 6–8 weeks old were (a) left naïve (white bars) or immunized once with 10ug of spike plasmid DNA (pS, gray bars) or co-immunized with 10ug pS and 10ug of plasmid-encoded adenosine deaminase-1 (+pADA, purple bars); SARS-CoV-2 S1 (b) and RBD (c) antibodies were quantified in serum longitudinally via ELISA. Area under the curve analysis was performed using R to assess differences in S1 IgG (d) and RBD IgG (e) across all timepoints. Serum pseudovirus neutralization capacity was determined at matched timepoints by a pseudovirus cell infection inhibition assay (f). Serum antibody affinity (KD) was determined by surface plasmon resonance at matched timepoints for RBD (g-h) Each point represents the average of duplicate samples from an individual animal (b-c, f), bars represent the mean, and error bars represent the SEM (b-c, f) or SD (g). *p<0.05, **p<0.01, ***p<0.001, and ****p<0.0001 as measured by Kruskall-Wallis ANOVA (b-c, f) or Mann-Whitney U-test (g). Binding profiles points (1Hz) were averaged, and SEM shown using identical color code (h). Data are representative of one independent experiment with N=5 mice per group.
ADA-1 enhances antibody neutralization and affinity.
We measured the ability of sera from immunized mice to neutralize SARS-CoV-2 pseudotyped viruses in vitro. Sera from pADA-co-immunized animals displayed increased neutralization capacity compared to pS only immunized animals out to day 127 post-immunization (Fig. 1f). Specifically, ADA-1 improved Ab neutralization abilities at days 35, 56 and 127 in co-immunized mice when compared to those elicited in the absence of ADA-1. Antibodies levels elicited at day 56 post vaccination showed a significant difference (p=0.0257). We further evaluated the affinity of vaccine-induced polyclonal mouse sera for SARS-CoV-2 spike antigens. Specific binding of serum polyclonal antibodies to RBD from pS-only and pADA co-immunized mice was measured using a rapid surface plasmon resonance (SPR) screening assay for initial rates of binding. The follow-up SPR kinetic analysis of IgG binding allowed us to measure quantitative aspects of Ab binding such as the equilibrium association constants (affinity, KA or KD). KA values measured the amount of antibody-antigen complex formed at equilibrium, independent of concentration. We examined the impact of ADA-1 on the affinity of anti-RBD Ab (Fig. 1g–h) at multiple days post vaccination. We showed that ADA-1 significantly improved the affinity of anti-RBD antibodies at day 35 (p=0.0238), day 56 (p=0.0079) and importantly a durable affinity at day 127 (p=0.0286) was observed. Taken together, these data suggest that pADA co-immunization has functional and qualitative impact on vaccine-induced humoral responses, supporting strong and durable virus neutralization and antigen affinity.
ADA-1 induces durable antigen-specific T follicular helper cell responses.
Because the magnitude and quality of antibody response depends on persistent TFH response, we determined whether pADA can elicit a durable TFH function. For this, we utilized T cell receptor (TCR) dependent activation induced marker (AIM) assays to identify and quantitate SARS-CoV-2-specific germinal center TFH cells in vaccinated mice as a marker of robust germinal center responses (Fig. 2) as previously reported11, 12. 6–8week old C57BL/6 mice (n=8, 4 male and 4 female) were immunized with pS alone or in combination with pADA and were sacrificed at day 14 and 74 post immunization to measure early and late TFH cell responses (Fig. 2a). We stimulated splenocytes from mice vaccinated with pS alone or co-immunized with pADA with five peptide pools encompassing the entire Spike protein. Concanavalin A was used a positive control, while DMSO was used as the negative control. Gating strategies to determine SARS-CoV-2 spike-specific AIM+ TFH cells (OX40+41BB+) and RBD+ Memory B cells are shown in Fig. 2b and Fig. 2c. SARS-CoV-2 spike-specific TFH (Fig. 2d) cells as measured by the AIM assay, were significantly increased in both groups of mice (pS p=0.044, pADA p=0.044) at day 14 post immunization when compared to immunization with empty vector pVax. Importantly at day 74 post immunization, the frequency of SARS-CoV-2 spike-specific TFH cells in the pS vaccination group significantly contracts (p=0.0104, average frequency=0.91%) while the frequency of SARS-CoV-2 spike-specific TFH in the pADA co-immunized mice remains at similar frequency as day 14 (average frequency at day 14= 4.9%, average frequency at day 74= 4.0%) suggesting a sustained germinal center response with robust antibody production. Frequency of total TFH cells was not changed at early (day 14) and late (day 74) post vaccination in both groups of mice (Fig. 2e) when compared to empty vector immunization probably due to kinetics of the peak of total TFH response which could have occurred at earlier time points.
Figure 2. pADA co-immunization supports sustained TFH and B cell responses.
(a) Mice were immunized once with pS alone or co-immunized with pS and pADA (+pADA) and sacrificed at either day 14 or day 74 post immunization. (b) Gating schemes are depicted for AIM+ memory Tfh and (c) RBD+ memory B cell. (d) The frequency of total Tfh cells and (e) SARS-CoV-2 specific Tfh cells were measured. SARS-CoV-2 specific Tfh were quantified as percentage of AIM+ (OX40+41BB+) cells after stimulation of splenocytes with peptide pools encompassing spike only (pS). Background from DMSO treated splenocytes was subtracted from peptide treated splenocytes and the data are shown with geometric mean and geometric standard deviation. (f) The frequency of total plasmablasts (% of CD19+ B cells) (g) and SARS-CoV-2 RBD-specific memory B cells (% of CD19+ CD38+ B cells) were measured. *p < 0.05; **p<0.01; ***p < 0.001 as measured by two-tailed unpaired t-test. Data are representative of one independent experiment with N=8 mice per group.
ADA-1 induces durable antigen-specific memory B cell responses.
We further determined whether durable antibody response observed in the presence of ADA-1 is because of a durable antigen-specific B cell response. Therefore, we measured the frequency of SARS-CoV-2 RBD-specific memory B cells (Fig. 2f) and Plasmablasts (Fig. 2g) at day 14 and day 74 post immunization. Ag-specific memory B cells were monitored by fluorescently labeled multimerized probes specific to RBD and plasmablasts were gated as CD19+ CD138+. Analysis of mice that were either immunized with pS or co-immunized with pS and pADA revealed that frequencies of SARS-CoV-2 RBD-specific memory B cells were significantly higher in both groups of mice at day 14 post immunization when compared to empty vector (pS p=0.0182, pADA p=0.0121). Importantly, mice that were co-immunized with pADA showed a significant (p=0.0285) durable response at day 74 post immunization demonstrating when compared to pS alone suggesting the ability of the vaccine to induce SARS-CoV-2 specific memory responses that last at least two months post vaccination (Fig. 2f). pADA co-immunized mice also exhibited increased frequencies of CD138+ plasmablasts at day 74 post immunization compared to mice immunized with pS alone despite this increase not reaching statistical significance (Fig. 2g). Taken together, these data demonstrate that pS and pADA co-immunization induces more robust and durable antigen specific memory B cell responses compared to immunization with antigen (pS) alone.
ADA-1 enhances T cell monofunctionality and polyfunctionality.
The T-cell response to a single immunization with pS alone or pADA co-immunization was determined via splenocyte stimulation with peptides encompassing SARS-CoV-2 Spike followed by flow cytometry analysis. The frequencies of both monofunctional and polyfunctional CD8+ (Fig. 3a–b) and CD4+ (Fig. 3c–d) T cells were quantified using the gating strategy shown in Supplemental Figure 1. In ADA co-immunized mice we observed a near significant increase (p=0.0688) in the frequency of TNFα+ monofunctional CD8+ T cells (Fig. 3a) and a significant increase in the frequency of TNFα+ (p=0.0025) and IL2+ (p=0.0112) monofunctional CD4+ T cells (Fig. 3c) 14 days post immunization when compared to pS alone. At this timepoint we also observed a significant boost in triple-positive (IFN-γ+/TNF-α+/IL-2+) (p=0.0463) cells as well in IFN-γ+/IL2+ double positive (p=0.0127) CD8+ T cells in the presence of ADA. An apparent increase in IFN-γ+/TNF+ double positive CD8+ T cells was observed despite not being significant (Fig. 3a). Similarly, we found a significant increase in IFN-γ+/TNF+/IL-2+ triple positive (p=0.0002) and TNF+/IL-2+ double positive (p=0.0044) CD4+ T cells in ADA co-immunized mice when compared to pS alone (Fig. 3c).
Figure 3. pADA co-immunization enhances and sustains cellular immunity in vivo.
Mice were immunized as in Fig. 2 and rested for 14 or 74 days, and cellular responses were assessed in spleens. Frequencies of cytokine positive CD8+ T cells were quantified by intracellular cytokine staining at days 14 (a) and 74 (b) post-immunization. Frequencies of cytokine positive CD4+ T cells were quantified by intracellular cytokine staining at days 14 (c) and 74 (d) post-immunization. Bars represent the mean and error bars represent the SD. Symbols represent individual animals. *p<0.05, **p<0.01, **p<0.001, ****p<0.0001 as measured by Mann-Whitney U-test (a-d). Data are representative of one experiment with N=8 mice per group.
To understand the durability of the T cell response, CD4+ and CD8+ T cell responses were also measured at 74 days post immunization. TNFα+ monofunctional CD8+ (Fig. 3b) and CD4+ T (Fig. 3d) cells and IL-2+ monofunctional CD8+ T cells (Fig. 3b) persisted at significantly increased frequencies in ADA co-immunized mice (p=0.0079, p=0.0238 and p=0.0079 respectively) when compared to pS alone. In terms of polyfunctionality, we found that IFN-γ+/IL-2+ double positive CD8+ T cells persisted (Fig. 3b). An increase in IFN-γ+/TNF-α+ and TNF-α+/IL-2+ double positive CD4+ T cells was observed in ADA co-immunized mice however, this increase was not significant (Fig. 3d). Similarly, when BALB/c mice were immunized once with a sub-optimal dose of pS (5ug) alone or co-immunized with 5ug or 10ug of pADA, we observed a pADA-induced enhancement of cellular immunity at both acute (Supplemental Figure 3A and 3B) and memory timepoints (Supplemental Figure 3D), suggesting that the ability of pADA to enhance cellular responses is not mouse strain-specific. These data suggest that pADA co-immunization supports vaccine-induced cellular immunity.
pADA co-immunization enhances protection in an AAV6.2FF-mediated hACE2 transduction model of SARS-COV-2 Challenge.
We previously reported that transduction of the mouse respiratory tract with modified adeno-associated virus-6 (AAV6.2FF) results in robust transgene expression in the lung13. Recently we extended this work to model SARS-CoV-2 infection by expressing human angiotensin converting enzyme-2 (hACE2) and demonstrated that this model supports replication of wild-type SARS-CoV-2 in the lungs of mice and provides an easily accessible experimental system with which to evaluate the efficacy of anti-SARS-CoV-2 vaccines and therapeutics10. Using this model, we evaluated the effect of pADA co-immunization on the efficacy of our SARS-CoV-2 synDNA antigens. BALB/c mice were immunized at week 0 and 4 or week 4 only with 10ug of SARS-CoV-2 spike DNA (pS) alone or co-immunized with 10ug of pS and 10ug of plasmid-encoded ADA-1 (pADA) (Fig. 4a). In this instance we observed trends toward enhanced serum pseudovirus neutralization capacity at day 14 post final immunization (Fig. 4b). After the final immunization, mice were transduced with AAV6.2FF-hACE2 and challenged two weeks later with 105 TCID50 of SARS-CoV-2 (VIDO-01). Animals were sacrificed at four days post infection to quantify viral loads. While a single immunization with pS alone protected 40% of animals from viral replication as measured by TCID50 assay, a single pADA + pS co-immunization protected 100% of animals from viral replication (Fig. 4c). All immunized animals had decreased viral loads as measured by qPCR at the time of sacrifice (Fig. 4d). Importantly we were able to demonstrate an inverse correlation between serum pseudovirus neutralization capacity pre-challenge with post-challenge TCID50s (Fig. 4e). Similar correlations were observed between pre-challenge serum assays and viral RNA loads at sacrifice (Fig. 4f). These data indicate that pS co-immunization with pADA not only enhances the magnitude of humoral and cellular responses but has significant impact on challenge outcome in this model of wild-type SARS-CoV-2 infection.
Figure 4. Co-immunization with pADA enhances protection from SARS-COV-2 challenge.
(a) BALB/c mice were immunized once or twice separated by four weeks with 10ug of pS or 10ug of pS with 10ug of pADA (+pADA). Serum was collected at day 14 post-first immunization. At 42 days post-final immunization mice were intranasally transduced with adeno-associated virus expressing human ACE2 (AAV6.2FF hACE2). 7 days following AAV6-ACE2 transduction, animals were intranasally infected with 1×105 PFU of SARS-CoV-2 VIDO-01 P2. Four days post infection, animals were sacrificed to quantify viral replication. Measurements were made for (b) pseudoviral neutralization titers at day 14 post-first immunization, replication competent virus via TCID50 (c), and viral RNA (d) in the lungs four-days post-infection. Pearson correlations were made between virus titers at day 4 post-challenge and day 14 post-1 immunization neutralization titers (e). Pearson correlations were made between viral RNA copies and neutralization titers (f). BALB/c mice were immunized once or twice separated by four weeks with 10ug of pS or 10ug of pS with 10ug of pADA (+pADA) and rested for over one year. At 404 days post-final immunization mice were AAV6.2FF-hACE2 transduced and infected with 1×105 PFU of SARS-CoV-2 VIDO-01 P2 (g). Four days post infection, animals were sacrificed to quantify viral replication. Replication competent virus (h), and viral RNA (i) was quantified in the lungs four-days post-infection. Each point represents the average of duplicate samples from an individual animal (b), bars represent the mean, and error bars represent the SEM. **p<0.01, ****p<0.0001 as measured by Kruskal-Wallis ANOVA. Each symbol represents an individual animal, lines represent the mean, *p<0.05, **p<0.01, ****p<0.0001 as measured by Kruskal-Wallis ANOVA compared to naïve or pVax treated animals (c-d and h-i). Data are representative of two experiments with N=5–10 mice per group.
To evaluate the longevity of pADA-induced enhanced protection in this model, animals were rested for over one year prior to AAV6.2FF-hACE2 transduction and SARS-CoV-2 challenge (Fig. 4g). At this memory time point, animals receiving a single immunization with either pS alone or pS and pADA had similar amounts of detectable virus in their lungs. Animals receiving two pADA co-immunizations were completely protected from viral replication as measured by TCID50 assay compared to 60% of animals receiving two pS-only immunizations. (Fig. 4h). All immunized animals had decreased viral loads as measured by qPCR at the time of sacrifice (Fig. 4i). These data suggest that pADA co-immunization enhances synDNA vaccine-induced immune memory and supports the continued study of adenosine deaminase as an adjuvant to enhance both the magnitude and duration of antigen-specific immunity.
Discussion:
It is becoming increasingly evident that most vaccines targeting SARS-CoV-2 do not induce durable antibody responses leading to a loss of protection against infection2, 3, 4. Thus, novel adjuvants that can improve COVID-19 vaccine durability and quality would represent important targets for development.
The most effective vaccines induce durable immunity through germinal center reactions resulting in long-lived plasma cells and memory B cells. Germinal centers (GC) are dynamic sites within secondary lymphoid organs, where follicular helper T cells (TFH) provide physical and cytokine-mediated stimulus to B cells resulting in somatic hypermutation and class-switching of B cell receptors and differentiation to durable memory B cells and long-lived plasma cells.14 Thus, molecules such as adenosine deaminase-1 (ADA) that target TFH cells would improve humoral immunity and probably induce long-lived humoral and cellular responses.
We have previously shown that ADA is critical molecule of TFH cell profile. Co-culture of TFH with autologous B cells in the presence of ADA inhibitors blunted antibody secretion6. We further reported that co-delivery of plasmid-encoded adenosine deaminase (pADA) with an HIV-1 envelope DNA vaccine enhanced the formation of HIV-specific antibodies9. This enhancement was associated with increased frequencies of germinal center TFH and resulted in the development of autologous HIV-1 virus neutralization9.
Here we showed that that ADA elicited long-term survival of SARS-CoV-2-specific TFH cells and RBD-specific memory B cells for more than 4 months after vaccination. In the absence of ADA, most of these antigen specific TFH and memory B cells waned significantly. The enhanced differentiation and persistence of SARS-CoV-2-specific TFH driven by ADA supports the enhanced anti-RBD and anti-S1 antibody quantities, affinity, and neutralization we observed in ADA immunized mice. ADA promotion of TFH differentiation may be driven by the ability of ADA to promote dendritic cell maturation and production of IL-6, a cytokine known to play a crucial role in regulating TFH cell differentiation and effector functions9,15. IL-6 has also been shown to induce the differentiation of IL-21 producing CD8+ T cells that provide B cell help and promote antibody production15. IL-21 production from both CD8+ T cells15 and CD4+ T cells16 has been shown to enhance the cytolytic activity of CD8+ T cells16 which is in line with the enhanced and durable cellular immunity observed in ADA immunized mice.
We hypothesize that ADA promotes survival of TFH and memory B cells in vivo by enhancing survival signals provided by B cell:T cell interactions such as CD40-CD40L binding17. Pro-longed survival of TFH and memory B cells provides ample time for these cells to interact in germinal centers. This could lead to the early and persistent accumulation of GC TFH cells providing an extended time of interaction between TFH and B cells in GC follicles, a process which favors enhanced somatic mutations and conversion of low affinity B cell clones to high affinity B cell clones. Our results of ADA induced prolonged survival of SARS-CoV-2-specific TFH cells and RBD-specific memory B cells in addition to the enhancement of overall anti-spike antibody levels, affinity and neutralization strongly support this notion.
We interrogated the function of pADA-induced vaccine responses in an AAV6.2FF human ACE2 transduction model of SARS-CoV-2 infection in mice10. In this model, we generated long-term expression of human ACE2 in the respiratory tract of wild-type mice, making them susceptible to SARS-CoV-2 infection. Transient models of human ACE2 expression in the mouse lung such as the model used here, can provide rapid, quantifiable insights into vaccine-mediated protection in mice. In this model we observed that a single pADA co-immunization enhances protection with 100% of co-immunized animals protected from viral replication as measured by TCID50 compared with only 40% of pS-only immunized animals being protected. These data confirm our previous report that a single pS immunization only protects 50% of animals from replication in this model10. Importantly when animals were rested for over a year and challenged in the model system, pADA co-immunization significantly impacted challenge outcomes. While two immunizations were needed to observe statistically significant decreases in replication-competent virus in the lung post-challenge, only 60% of the animals receiving two immunizations with pS alone displayed significantly decreased viral levels, while 100% of pADA co-immunized animals had viral levels under the limit of detection. When viral RNA was measured by qPCR only animals receiving pADA co-immunization (both one and two doses) had viral RNA loads that were decreased compared to naïve animals. These data suggest that pADA has significant impact on SARS-CoV-2 challenge outcome. We strongly believe that protection against SARS-CoV-2 infection in the presence of ADA is due to a combination of humoral and cellular effector functions that are improved in the presence of ADA.
Adenosine-deaminase replacement therapy using PEGylated bovine ADA in patients with severe-combined immunodeficiency (SCID) is well-tolerated with only minor short-term side effects observed, even in pediatric patient populations18. These studies demonstrate a novel use of a molecule with a proven record of clinical safety in the context of the safe, well-tolerated, and immunogenic synDNA platform. The use of ADA-1 to adjuvant SARS-CoV-2 synDNA vaccine-induced responses represents a novel repurposing of an extant therapy with the potential to be fast-tracked for clinical application.
Supplementary Material
Manuscript key findings:
ADA-1 enhances humoral responses by inducing durable and high affinity antibody.
ADA-1 enhances cellular responses by inducing durable antigen specific T and B cells.
ADA-1 enhanced humoral and cellular responses translated to increased protection.
Acknowledgements:
The authors thank the animal facility and the flow cytometry facility at The Wistar Institute, and the animal and containment facilities at Public Health Agency of Canada for help with multiple aspects of the studies reported. The authors also thank the animal facility at Drexel University for their help in the project. We acknowledge Inovio pharmaceuticals for the use of the CELLECTRA device for electroporation.
Funding: This work was supported by the Drexel Trustee fund for COVID-19 research, the PA Department of Community & Economic Development COVID AID, Relief and Economic Security (CARES) act (MAK, EEH, IC) and NIH supplement # U19AI128910-04S1 (EKH). Additional support was provided by CEPI/Inovio Pharmaceuticals. NIH NCI award T32 CA09171 (ENG), The Wistar Institute COVID-19 science discovery fund and the WWSmith Charitable Trust (DBW) was also used to support this work.
Abbreviations used in this article:
- SARS-CoV-2
Severe acute respiratory syndrome coronavirus 2
- VOCs
variants of concern
- ADA-1
Adenosine deaminase-1
- pADA
plasmid encoded adenosine deaminase-1
- synDNA
synthetic DNA
- pS
plasmid encoded spike
- AAV6.2FF-hACE2
adeno-associated virus-6.2FF human angiotensin converting enzyme-2
- RBD
receptor binding domain
- TFH
T follicular helper cell
- pAB
polyclonal antibody
- AUC
area under the curve
- AIM
activation induced marker
- hACE2
human angiotensin converting enzyme-2
References
- 1.Zhao Y, Fang C, Zhang Q, Zhang R, Zhao X, Duan Y, Wang H, Zhu Y, Feng L, Zhao J, Shao M, Yang X, Zhang L, Peng C, Yang K, Ma D, Rao Z, and Yang H. 2021. Crystal structure of SARS-CoV-2 main protease in complex with protease inhibitor PF-07321332. Protein & Cell. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Widge AT, Rouphael NG, Jackson LA, Anderson EJ, Roberts PC, Makhene M, Chappell JD, Denison MR, Stevens LJ, Pruijssers AJ, McDermott AB, Flach B, Lin BC, Doria-Rose NA, O’Dell S, Schmidt SD, Neuzil KM, Bennett H, Leav B, Makowski M, Albert J, Cross K, Edara V-V, Floyd K, Suthar MS, Buchanan W, Luke CJ, Ledgerwood JE, Mascola JR, Graham BS, and Beigel JH. 2020. Durability of Responses after SARS-CoV-2 mRNA-1273 Vaccination. New England Journal of Medicine 384: 80–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wu K, Choi A, Koch M, Ma L, Hill A, Nunna N, Huang W, Oestreicher J, Colpitts T, Bennett H, Legault H, Paila Y, Nestorova B, Ding B, Pajon R, Miller JM, Leav B, Carfi A, McPhee R, and Edwards DK. 2021. Preliminary Analysis of Safety and Immunogenicity of a SARS-CoV-2 Variant Vaccine Booster. medRxiv: 2021.2005.2005.21256716. [Google Scholar]
- 4.Naaber P, Tserel L, Kangro K, Sepp E, Jürjenson V, Adamson A, Haljasmägi L, Rumm P, Maruste R, Kärner J, Gerhold JM, Planken A, Ustav M, Kisand K, and Peterson P. 2021. Declined antibody responses to COVID-19 mRNA vaccine within first three months. medRxiv: 2021.2004.2019.21255714. [Google Scholar]
- 5.McMahan K, Yu J, Mercado NB, Loos C, Tostanoski LH, Chandrashekar A, Liu J, Peter L, Atyeo C, Zhu A, Bondzie EA, Dagotto G, Gebre MS, Jacob-Dolan C, Li Z, Nampanya F, Patel S, Pessaint L, Van Ry A, Blade K, Yalley-Ogunro J, Cabus M, Brown R, Cook A, Teow E, Andersen H, Lewis MG, Lauffenburger DA, Alter G, and Barouch DH. 2021. Correlates of protection against SARS-CoV-2 in rhesus macaques. Nature 590: 630–634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Tardif V, Muir R, Cubas R, Chakhtoura M, Wilkinson P, Metcalf T, Herro R, and Haddad EK. 2019. Adenosine deaminase-1 delineates human follicular helper T cell function and is altered with HIV. Nature Communications 10: 823. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pacheco R, Martinez-Navio JM, Lejeune M, Climent N, Oliva H, Gatell JM, Gallart T, Mallol J, Lluis C, and Franco R. 2005. CD26, adenosine deaminase, and adenosine receptors mediate costimulatory signals in the immunological synapse. Proc Natl Acad Sci U S A 102: 9583–9588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Martinez-Navio JM, Climent N, Pacheco R, Garcia F, Plana M, Nomdedeu M, Oliva H, Rovira C, Miralles L, Gatell JM, Gallart T, Mallol J, Lluis C, and Franco R. 2009. Immunological dysfunction in HIV-1-infected individuals caused by impairment of adenosine deaminase-induced costimulation of T-cell activation. Immunology 128: 393–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gary E, O’Connor M, Chakhtoura M, Tardif V, Kumova OK, Malherbe DC, Sutton WF, Haigwood NL, Kutzler MA, and Haddad EK. 2020. Adenosine deaminase-1 enhances germinal center formation and functional antibody responses to HIV-1 Envelope DNA and protein vaccines. Vaccine 38: 3821–3831. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Gary EN, Warner BM, Parzych EM, Griffin BD, Zhu X, Tailor N, Tursi NJ, Chan M, Purwar M, Vendramelli R, Choi J, Frost KL, Reeder S, Liaw K, Tello E, Ali AR, Yun K, Pei Y, Thomas SP, Rghei AD, Guilleman MM, Muthumani K, Smith T, Wootton SK, Patel A, Weiner DB, and Kobasa D. 2021. A novel mouse AAV6 hACE2 transduction model of wild-type SARS-CoV-2 infection studied using synDNA immunogens. iScience 24: 102699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Smith TRF, Patel A, Ramos S, Elwood D, Zhu X, Yan J, Gary EN, Walker SN, Schultheis K, Purwar M, Xu Z, Walters J, Bhojnagarwala P, Yang M, Chokkalingam N, Pezzoli P, Parzych E, Reuschel EL, Doan A, Tursi N, Vasquez M, Choi J, Tello-Ruiz E, Maricic I, Bah MA, Wu Y, Amante D, Park DH, Dia Y, Ali AR, Zaidi FI, Generotti A, Kim KY, Herring TA, Reeder S, Andrade VM, Buttigieg K, Zhao G, Wu J-M, Li D, Bao L, Liu J, Deng W, Qin C, Brown AS, Khoshnejad M, Wang N, Chu J, Wrapp D, McLellan JS, Muthumani K, Wang B, Carroll MW, Kim JJ, Boyer J, Kulp DW, Humeau LMPF, Weiner DB, and Broderick KE. 2020. Immunogenicity of a DNA vaccine candidate for COVID-19. Nature Communications 11: 2601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Gary EN, Warner BM, Parzych EM, Griffin BD, Zhu X, Tailor N, Tursi NJ, Chan M, Purwar M, and Vendramelli R. 2021. A novel mouse AAV6 hACE2 transduction model of wild-type SARS-CoV-2 infection studied using synDNA immunogens. Iscience 24: 102699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Aurnhammer C, Haase M, Muether N, Hausl M, Rauschhuber C, Huber I, Nitschko H, Busch U, Sing A, Ehrhardt A, and Baiker A. 2012. Universal real-time PCR for the detection and quantification of adeno-associated virus serotype 2-derived inverted terminal repeat sequences. Hum Gene Ther Methods 23: 18–28. [DOI] [PubMed] [Google Scholar]
- 14.Reiss S, Baxter AE, Cirelli KM, Dan JM, Morou A, Daigneault A, Brassard N, Silvestri G, Routy J-P, and Havenar-Daughton C. 2017. Comparative analysis of activation induced marker (AIM) assays for sensitive identification of antigen-specific CD4 T cells. PloS one 12: e0186998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Rydyznski Moderbacher C, Ramirez SI, Dan JM, Grifoni A, Hastie KM, Weiskopf D, Belanger S, Abbott RK, Kim C, Choi J, Kato Y, Crotty EG, Kim C, Rawlings SA, Mateus J, Tse LPV, Frazier A, Baric R, Peters B, Greenbaum J, Ollmann Saphire E, Smith DM, Sette A, and Crotty S. 2020. Antigen-Specific Adaptive Immunity to SARS-CoV-2 in Acute COVID-19 and Associations with Age and Disease Severity. Cell 183: 996–1012.e1019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.van Lieshout LP, Domm JM, Rindler TN, Frost KL, Sorensen DL, Medina SJ, Booth SA, Bridges JP, and Wootton SK. 2018. A novel triple-mutant AAV6 capsid induces rapid and potent transgene expression in the muscle and respiratory tract of mice. Molecular Therapy-Methods & Clinical Development 9: 323–329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lederer K, Castaño D, Gómez Atria D, Oguin TH 3rd, Wang S, Manzoni TB, Muramatsu H, Hogan MJ, Amanat F, Cherubin P, Lundgreen KA, Tam YK, Fan SHY, Eisenlohr LC, Maillard I, Weissman D, Bates P, Krammer F, Sempowski GD, Pardi N, and Locci M. 2020. SARS-CoV-2 mRNA Vaccines Foster Potent Antigen-Specific Germinal Center Responses Associated with Neutralizing Antibody Generation. Immunity 53: 1281–1295.e1285. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yang R, Masters AR, Fortner KA, Champagne DP, Yanguas-Casás N, Silberger DJ, Weaver CT, Haynes L, and Rincon M. 2016. IL-6 promotes the differentiation of a subset of naive CD8+ T cells into IL-21-producing B helper CD8+ T cells. J Exp Med 213: 2281–2291. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zander R, Schauder D, Xin G, Nguyen C, Wu X, Zajac A, and Cui W. 2019. CD4(+) T Cell Help Is Required for the Formation of a Cytolytic CD8(+) T Cell Subset that Protects against Chronic Infection and Cancer. Immunity 51: 1028–1042.e1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Dadgostar H, Zarnegar B, Hoffmann A, Qin XF, Truong U, Rao G, Baltimore D, and Cheng G. 2002. Cooperation of multiple signaling pathways in CD40-regulated gene expression in B lymphocytes. Proc Natl Acad Sci U S A 99: 1497–1502. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Gaspar B. 2009. Pegademase bovine (PEG-ADA) for the treatment of infants and children with severe combined immunodeficiency (SCID. Biologics: Targets & Therapy: 349. [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.




