Table 1.
AS RT-qPCR primer sequences. Allele-specific nucleotides are marked bold. Gen denotes general (common primers), and are used in both WT and omicron-specific reactions. Om denotes Omicron, and is used in Omicron-specific reactions. WT denotes wild type, and is used for WT (non-Omicron)-specific reactions.
Location and amino acid position(s) | Primer name | Oligonucleotide Sequence (5’>3’) | Amplicon size (bp) | Reference |
---|---|---|---|---|
Spike protein 493–498 | F-WT-493–498 F-Om-493–498 Ps-Gen-493–498 R-Gen-493–498 |
CTTTCCTTTACAATCATATGGTTTCCA CTTTCCTTTACGATCATATAGTTTCCG /56-FAM/ACCCACTWATGGTGTTGGTYACCA/3BHQ_1/ AGTTGCTGGTGCATGTAGAA |
103 | This paper |