Skip to main content
. Author manuscript; available in PMC: 2023 Jul 3.
Published in final edited form as: Stem Cell Res. 2022 Jan 3;59:102657. doi: 10.1016/j.scr.2022.102657

Table 2.

Reagents details.

Antibodies used for immunocytochemistry/flow-cytometry
Antibody Dilution Company Cat # RRID
Pluripotency marker Rabbit Anti-Nanog 1:200 Protein tech Cat# 142951-1-AP AB_1607719
Pluripotency marker Mouse IgG2bκ Anti-Oct-3/4 1:200 Santa Cruz Biotechnology Cat# sc-5279 AB_628051
Pluripotency marker Mouse IgG1κ Anti-Sox2 1:200 Santa Cruz Biotechnology Cat# sc-365823 AB_10842165
Ectoderm marker Goat Anti-Otx2 1:200 R&D Systems Cat# 963273 AB_2157172
Ectoderm marker Rabbit Anti-Pax6 1:100 Thermo Fisher Scientific Cat # 42-6600 AB_2533534
Mesoderm marker Goat Anti-Brachyury 1:200 R&D Systems Cat# 963427 AB_2200235
Mesoderm marker Rabbit Anti-Tbx6 1:200 Thermo Fisher Scientific Cat# PA5-35102 AB_2552412
Endoderm marker Goat Anti-Sox17 1:200 R&D Systems Cat# 963121 AB_355060
Endoderm marker Rabbit Anti-Foxa2 1:250 Thermo Fisher Scientific Cat# 701698 AB_2576439
Secondary antibody Alexa Flour 488 Goat Anti-Mouse IgG1 1:1000 Thermo Fisher Scientific Cat#A-21121 AB_2535764
Secondary antibody Alexa Flour 488 Donkey Anti-Goat IgG (H + L) 1:1000 Thermo Fisher Scientific Cat#A-11055 AB_2534102
Secondary antibody Alexa Fluor 555 Goat Anti-Rabbit IgG (H + L) 1:500 Thermo Fisher Scientific Cat#A-21428 AB_141784
Secondary antibody Alexa Fluor 647 Goat Anti-Mouse IgG2B 1:250 Thermo Fisher Scientific Cat#A-21242 AB_2535811
Secondary antibody Alexa Fluor 555 Donkey Anti-Rabbit IgG (H + L) 1:500 Thermo Fisher Scientific Cat#A-31572 AB_2180682
Primers Target Size of band Forward/Reverse primer (5′−3′)
Sendai virus plasmid (qPCR) Sendai virus genome 181 bp Mr04269880_mr
Genotyping LMNA: c.398 G > A 280 bp F: CTGACCTCCTGGGAGCCT
R: CATGTGTTAGGTGGGGCCAT
House-keeping gene (qPCR) GAPDH 471 bp HS02786624_g1
Pluripotency genes (qPCR) SOX2 258 bp HS04234836_s1
NANOG 327 bp HS02387400_g1