Abstract
Background
Effective and successful treatment of infectious diseases is a significant gain in clinical settings. However, resistance to antibiotics, especially the last-resort medicines, including carbapenems and colistin is on the rise.
Aim
The aim of this study was to detect carbapenemase production and colistin-resistant genes in clinical isolates of Escherichia coli. Method. The study was a cross-sectional study carried out from July 2018 to June 2019. One hundred and thirty-five nonrepetitive E. coli isolates obtained from various clinical samples were screened for carbapenemase production using meropenem (10 μg) and imipenem (10 μg) disks. Screened-positive isolates were further subjected to a confirmatory test using modified carbapenem inhibition method (mCIM). Deoxyribonucleic acid (DNA) was extracted from all the isolates to detect colistin-resistant genes by polymerase chain reaction. Data were analyzed using GraphPad Prism version 8.00 for Windows and IBM SPSS version 26 (IMB Corp. New York, USA).
Results
Of the 135 isolates, 2 were screened positive for carbapenemase production but tested negative to mCIM. With the colistin-resistant genes, only mcr-1 and mcr-2_700bp were detected in 3 of the E. coli isolates, representing 2.2%. The mcr-1 was detected in a high vaginal swab sample of a female aged between 65 and 84 years. Mcr-2_700bp was also detected in urine and blood samples of the patients.
Conclusion
The study investigated the presence of carbapenemase and colistin-resistant genes in E. coli organisms. The absence of carbapenemase in the isolates and the detection of colistin-genes call for strict infection prevention and control practices to prevent their introduction and spread to other bacterial species, respectively.
1. Introduction
The discovery of antimicrobial agents has played a significant role in reducing the incidence of illness and death caused by microbial agents. The successful treatment of infectious diseases is one of the remarkable gains in modern medicine. The expansion in health systems and resources, in addition to improved production technologies across the globe, has also led to an increase in availability and ease of access to antimicrobials, especially, over-the-counter drugs. However, the improved access to these antimicrobials accompanied by poor practices has contributed to bacteria, including E. coli, to develop resistance to these life-saving drugs.
The rising rates of antimicrobial resistance continue to pose a grave threat to human health globally but more especially, in low- and middle-income countries, partly due to the high burden of communicable diseases [1]. It is estimated that antimicrobial resistance will cause 10 million deaths globally and an economic loss of over 100 trillion US dollars by the year 2050 [2]. The problem of antibiotic resistance is compounded by the resistance of the bacterial organisms to last-resort antibiotics, including carbapenems and colistin.
Until recently, carbapenems were the choice of treatment for multidrug-resistant Gram-negative bacterial infections [3]. Despite being generally considered as last-resort antibiotics [4], resistance to this class of antibiotics has been documented in previous studies [5–7]. Resistance of bacteria to carbapenems is due to the production of carbapenem-hydrolyzing enzymes called carbapenemases. These bacteria have the ability to spread rapidly within the hospital environment and from one country to another [8]. The occurrence of an outer membrane porin deficiency and the expression of a plasmid-mediated class C-lactamase have been reported to be responsible for carbapenem resistance in E. coli [9].
Colistin, on the other hand, has been used in treating infections caused by bacterial species in farm animals. The main indications for colistin use in veterinary settings are the prevention and treatment of infections caused by Enterobacteriaceae but it has also been used as a growth enhancer in terrestrial and aquatic animals [10, 11]. In recent times, colistin is being used in humans as a last-resort antibiotic in the treatment of infections caused by carbapenem-resistant Enterobacteriaceae. This has prompted more accurate and careful monitoring of resistance to this polypeptide [12]. The aim of this study was to investigate the production of carbapenemase and colistin-resistant genes in clinical isolates of E. coli from the Ho Teaching Hospital, Ghana.
2. Materials and Methods
2.1. Study Design and Study Area
The study was a cross-sectional study carried out at the Ho Teaching Hospital from July 2018 to June 2019. The hospital is a 241-bed capacity tertiary medical facility located in the regional capital of the Volta Region, Ho. The microbiology department of the hospital receives laboratory requests for various microbiological analyses from various units and departments of the hospital, as well as from the entire region and neighboring health facilities. Analysis of the samples were conducted in the Duedu Laboratory in the Department of Biomedical Science, School of Basic and Biomedical Sciences of the University of Health and Allied Sciences, in Ho which studies microbial ecology and biotechnology.
2.2. The Bacterial Isolates
E. coli isolates were cultured from various clinical specimens on MacConkey agar (Oxoid, UK) and blood agar (Oxoid, UK). The plates were incubated aerobically for 24 hours at 37°C. Growths suspected to be E. coli were confirmed using Gram stain reaction, triple sugar fermentation test, citrate test, urease test, indole test, Voges–Proskauer, and methyl red tests. Confirmation was done by detection of the presence of uidA and uspA genes that are specific to E. coli by PCR. Primers used to amplify these genes are shown in Table 1. The organisms isolated and confirmed as E. coli were stored in glycerol stocks in a −80°C freezer and later used for other tests. Quality control organisms used in the study were E. coli ATCC 25922 and Klebsiella pneumoniae NCTC 13442. K. pneumoniae was used as a negative control for the biochemical tests except for triple sugar ion fermentation in which both E. coli and K. pneumoniae share common characteristics.
Table 1.
Oligonucleotide primers used for the molecular identification of E. coli.
2.3. Revival of Isolates and DNA Extraction
The stored E. coli isolates were retrieved from the freezer, and the surface was scraped aseptically and emulsified in a 30 ml Luria Bertani broth (Oxoid, UK) and incubated overnight in a shaking incubator. The genomic DNA was extracted according to a previous technique used by Deku, Duedu [14].
2.4. Screening of E. coli Isolates for Carbapenemase Production
The disk diffusion Kirby-Bauer antimicrobial susceptibility testing method was used to detect carbapenemase production against meropenem (10 μg) and imipenem (10 μg). Three well-isolated colonies of E. coli were touched and emulsified in 4 ml of a sterile phosphate buffered saline. The density of the inoculum was adjusted to 0.5 McFarland. The Mueller–Hinton agar (Oxoid, UK) was inoculated by dipping a sterile swab into the inoculum and streaking the entire surface of the medium. A duration of ten minutes was allowed to enable the surface moisture to dry before the antibiotic disks were placed on the medium using sterile forceps. The inoculated plates containing the antibiotic disks were incubated aerobically at 37°C for 16–18 hours. The diameter of the zone of inhibition was measured using a ruler and was recorded. Isolates that were resistant (zone diameter ≤19 mm) to either one or two of the carbapenem antibiotic disks were suspected of carbapenemase production and were subjected to modified the carbapenem inhibition method (mCIM).
2.5. Confirmation of Carbapenemase Production Using mCIM
This test was performed by emulsifying a 10 μl loopful of E. coli culture from the Mueller–Hinton agar into 400 μl of sterile saline [15]. A 10 μg meropenem disk was completely immersed into the suspension using sterile forceps. The inoculum containing the immersed disk was incubated for four hours at 37°C aerobically. Immediately before the completion of the saline meropenem incubation, a 0.5 McFarland suspension was prepared using a controlled E. coli ATCC 25922 organism in sterile normal saline. The Mueller–Hinton agar was inoculated with the control organism according to a routine disk diffusion procedure and the plates were allowed to dry for 10 minutes [16]. The meropenem disk was removed from the suspension using a loop. Excess fluid was removed from the disk by dragging and pressing the loop along the inside wall of the tube. The disk was added to the seeded Mueller–Hinton plate and incubated at 37°C for 18 hours aerobically. If the isolate was a carbapenemase producer, the meropenem in the susceptibility disk would have been inactivated by allowing uninhibited growth (6 mm–15 mm) of the susceptible E. coli strain (positive carbapenemase test). Disks incubated in suspensions that did not contain carbapenemase produced a clear inhibition zone (≥19 mm) (negative carbapenemase test) [16, 17]. A zone size of 16 mm–18 mm was considered as indeterminate [16].
2.6. Molecular Detection of Colistin-Resistant Genes
The DNA extracted from the 135 isolates were subjected to polymerase chain reaction to determine the amplification of mcr genes using primers given in Table 2. The amplification was done using one taq quick-load 2x master mix with standard buffer. A total of 12.5 μl reaction volume was used, comprising 6.25 μl of one taq quick-load 2x master mix with standard buffer, 0.25 μl each of 10 μM forward and reverse primers, 1 μl of template DNA, and 4.75 μl of nuclease-free water. In all cases, the running conditions were as follows: 1 cycle of initial denaturation at 94°C for 10 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing (at temperature specific for primers) for 60 seconds, and extension at 72°C for 60 sec/kb. The final extension was done at 72°C for 10 minutes and held at 4°C. Thermal cycling was done using a thermocycler (Eppendorf, USA).
Table 2.
Primers for detection of colistin-resistant genes.
| Target gene | Primer | Sequence (5′-3′) | Amplification product (bp) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|
| mcr-1 | mcr-1F | ATCAGCCAAACCTATCCCATCG | 1257 | 55 | [18] |
| mcr-1R | GCAGACGCACAGCAATGCCTAT | ||||
|
| |||||
| mcr1_320 bp | mcr1_320 bp_F | AGTCCGTTTGTTCTTGTGGC | 320 | 58 | [19] |
| mcr1_320 bp_R | AGATCCTTGGTCTCGGCTTG | ||||
|
| |||||
| mcr-2 | mcr-2F | GCGATGGCGGTCTATCCTGTAT | 378 | 55 | [18] |
| mcr-2R | TGCGATGACATGGGGTGTCAGC | ||||
|
| |||||
| mcr-2_700 bp | mcr2_700 bp_F | CAAGTGTGTTGGTCGCAGTT | 715 | 58 | [19] |
| mcr2_700 bp_R | TCTAGCCCGACAAGCATACC | ||||
|
| |||||
| mcr-3 | mcr-3F | TATGGGTTACTATTGCTGG | 814 | 55 | [18] |
| mcr-3R | CTACCCTGATGCTCATCG | ||||
|
| |||||
| mcr3_900 bp | mcr3_900 bp_F | AAATAAAAATTGTTACGCTTATG | 929 | 58 | [19] |
| mcr3_900 bp_R | AATGGAGATCCCCGTTTTT | ||||
|
| |||||
| mcr-4 | mcr-4F | GTCATAGTGGTATAAAAGTACAG | 669 | 55 | [18] |
| mcr-4R | CCACCGTCTATCAGAGCCAAC | ||||
|
| |||||
| mcr_4_1100 bp | mcr_4_1100 bp_F | TCACTTTCATCACTGCGTTG | 1116 | 58 | [19] |
| mcr_4_1100 bp_R | TTGGTCCATGACTACCAATG | ||||
|
| |||||
| mcr-5 | mcr5_F | ATGCGGTTGTCTGCATTTATC | 1644 | 58 | [20] |
| mcr5_R | TCATTGTGGTTGTCCTTTTCTG | ||||
|
| |||||
| mmcr-5 | mcr-5F | GCGGTTGTCTGCATTTATCAC | 1042 | 50 | [18] |
| mcr-5R | CTTTGAAAACCTGTCTTTGGCA | ||||
|
| |||||
| mcr-6 | mcr-6F | GTCCGGTCAATCCCTATCTGT | 556 | 55 | [18] |
| mcr-6R | ATCACGGGATTGACATAGCTAC | ||||
|
| |||||
| mcr-7 | mcr-7F | TGCTCAAGCCCTTCTTTTCGT | 892 | 55 | [18] |
| mmcr-7R | TTCATCTGCGCCACCTCGT | ||||
|
| |||||
| mcr-8 | mcr-8F | AACCGCCAGAGCACAGAATT | 667 | 60 | [18] |
| mcr-8R | TTCCCCCAGCGATTCTCCAT | ||||
2.7. Statistical Analysis
GraphPad Prism version 8.00 for Windows and IBM statistical software Package for the Social Sciences (SPSS Inc. Chicago, USA) version 26.00 were used for the statistical analysis. Data obtained from the laboratory analysis were verified and exported to the statistical software for analysis. Data analysis included descriptive statistics, bivariate, and multivariate analyses by performing cross tabulations to obtain Fisher's chi squares for determination of statistical dependencies and risk associations of study variables.
2.8. Ethical Consideration
Ethical approval was granted by a joint committee of Komfo Anokye Teaching Hospital and School of Medical Sciences and Dentistry, Kwame Nkrumah University of Science and Technology, (with reference No. CHRPE/AP/204/18) before the commencement of the study. Data on study participants were anonymous and nonlinked to any of the participants. Isolates from the study participants were assigned study identification numbers.
3. Results
The study characterized a total of 135 clinical E. coli isolates recovered from the various clinical specimens of patients who visited the Ho Teaching Hospital for healthcare. Majority of the organisms (82.2%) were isolated from female participants and were mostly obtained from the 25–44 years age group 60 (44.4%). Christianity 128 (94.8%) was identified as the most professed religion among the patients. The isolates were mostly recovered from outpatients 98 (72.6%), who presented with urinary tract infections. Details of these results are presented in Table 3.
Table 3.
Sociodemographic characteristics of study respondents.
| Parameter | Frequency | Percentage |
|---|---|---|
| Age category (years) | ||
| <5 | 9 | 6.7 |
| 5–24 | 14 | 10.4 |
| 25–44 | 60 | 44.4 |
| 45–64 | 31 | 23 |
| 65–84 | 21 | 15.6 |
|
| ||
| Gender | ||
| Male | 24 | 17.8 |
| Female | 111 | 82.2 |
|
| ||
| Religion | ||
| None | 5 | 3.7 |
| Christian | 128 | 94.8 |
| Islam | 2 | 1.5 |
|
| ||
| Specimen type | ||
| Urine | 98 | 72.6 |
| Nonurine | 37 | 27.4 |
|
| ||
| Patient status | ||
| Outpatient | 98 | 72.6 |
| Inpatient | 37 | 27.4 |
When the 135 isolates were screened for carbapenemase production, only 2 were resistant to meropenem and imipenem. The suspected carbapenemase-producing isolates were however negative in the modified carbapenem inactivation method to confirm the production of carbapenemase.
With the colistin-resistant genes, it was observed that only resistant genes mcr-1 and mcr-2_700bp were detected in 3 of the E. coli isolates, representing 2.2% prevalence. The mcr-1 was detected in a high vaginal swab sample of a female aged between 65–84 years, whereas mcr-2_700 bp was also detected in both urine and blood samples of the patients, aged <5 years and between 5 and 24 years. See Table 4.
Table 4.
Proportional distribution of colistin-resistant genes among study participants.
| Parameter | Total | mcr 1 | mcr 1_320 bp | mcr 2 | mcr 2_700 bp | mcr 3 | mcr 3_900 bp | mcr 4 | mcr 4_1100 bp | mcr 5–1042 | mcr 5–1644 | mcr 6 | mcr 7 | mcr 8 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gender | ||||||||||||||
| Male | 24 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Female | 111 (100.0) | 1 (0.9) | 0 (0.0) | 0 (0.0) | 2 (1.8) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Total 1(0.7) | 135 (100) | 0 (0.0) | 0 (0.0) | 2 (1.5) | 0 (0.0) | 0 (0.0) | (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | |
|
| ||||||||||||||
| Age category(years) | ||||||||||||||
| <5 | 9 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (11.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| 5–24 | 14 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (7.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| 25–44 | 60 (100.00) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| 45–64 | 31 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| 65–84 | 21 (100.0) | 1 (4.8) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
|
| ||||||||||||||
| Specimen type | ||||||||||||||
| Urine | 98 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Blood | 5 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (20.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Ear swab | 5 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| HVS | 10 (100.0) | 1 (10.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Pleural | 1 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Sputum | 2 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
| Wound | 14 (100.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) |
4. Discussion
E. coli is a member of normal microflora of gastrointestinal tract of man and other animals and belongs to the family of Enterobacteriaceae. Although most strains are nonpathogenic in the gut, few can cause disease in man in the intestine or outside the intestine. Infections caused by this organism are treated with cephalosporins. However, there are reports of resistance to this class of antimicrobials due to the production of extend-spectrum beta-lactamases (ESBL). This has necessitated the use of carbapenem drugs. Carbapenems are antimicrobial agents that are used as last resorts in the treatment of infections caused by ESBL-producing bacteria.
There is, however, a growing concern about the emergence and spread of carbapenemase-producing bacteria. Contrary to the global increase in carbapenemase-producing organisms [21–23], our study detected two meropenem- and imipenem-resistant E. coli isolates that tested negative to mCIM. The screened-positive but negative confirmatory test may not connote carbapenemase production as other factors such as increased efflux pump activity and porin loss can also cause resistance [24, 25]. For infection prevention and control purposes, it is important to draw the distinction between carbapenem resistance due to carbapenemase production and resistance mediated by other mechanisms [15]. This is because most carbapenemase are plasmid encoded and can readily spread form one organism to the other. Since resistant genotypes can be transferred through crossborder migration, there is the need to put in place or enforce the existing infection prevention and control practices in the study area since carbapenemase production has been detected in other African countries, including 2.8% in Morocco [26], 28.6% in Uganda [23], 33.5% in Nigeria [27], and 35.24% in Tanzania [22].
Due to the emergence and rise of carbapenemase-producing bacteria in other countries, there is a need for proactive and adequate preventive measures locally, regionally, and nationally to contain the spread of these resistant bacteria [28]. Although, their detection can be difficult as their presence do not always produce resistant phenotypes on conventional disc diffusion or automated susceptibility testing methods [29], early detection through targeted laboratory protocols and containment of spread through comprehensive infection control measures are among appropriate preventive measures to take [28].
In this study, 3 E. coli isolates harbored one colistin resistant gene each, representing 2.2% of the total isolates. The resistance proportion recorded in this study is alarming since colistin has been regarded as a last-resort antibiotic [30, 31]. Previous studies recorded a lower prevalence in comparison with our current study [32–35]. These studies were designed to detect only mcr-1 resistant genotype, contrary to the current study where various oligonucleotide primers were used to detect a wide range of colistin resistant genes, including mcr-2, mc3-3, and mcr-4, among others. Other studies have reported a higher prevalence in comparison with this current study in Nigeria 8.3% [30] and Thailand 4.7% [36].
As at the year 2020, thirty-six studies were conducted to detect the presence of colistin-resistant genes in Africa and twenty-seven of these studies were carried out in North African countries [37]. The mcr genes have been reported in only six of the African countries and the distribution of these genes is also changing [37]. In those studies, mcr-1, mcr-2, mcr-3, and mcr-4 genes were detected in Northern Africa, while only mcr-1 genotypes were detected in Southern and Central African countries. Only two studies were conducted in Western Africa, specifically in Nigeria where only the mcr-1 genotype was detected. Our current study recorded mcr-1 1 (0.7%) and mcr-2–700 bp 2 (1.5%) among the 135 isolates tested.
Colistin has not been in use in the study hospital. It is possible that the 3 isolates carrying the colistin-resistant genes were present in the community where this class of antibiotic is used for agricultural purposes, rather than arising as a result of selective pressure in the hospital [38]. This calls for a judicious use of this antimicrobial agent in animals so as to retain its efficacious activity.
The predominant colistin-resistant genotype detected in this study was mcr-2_700 bp, with mcr-1 being the least. The mcr-2 predominance was in contrast with previous studies which reported mcr-1 majority [38]. A study conducted in 36 countries across the globe reported the detection of plasmid-mediated mcr-1, indicating the widespread presence of this colistin-resistant genotype [39]. The detection of other colistin-resistant genes in this study calls for regular monitoring and surveillance to prevent the spread of these resistant genotypes.
5. Conclusion
In conclusion, the study investigated the presence of carbapenemase and colistin-resistant genes in the E. coli organism. The absence of carbapenemase in the isolates coupled with the presence of mcr genes calls for strict infection prevention and control practices to prevent their introduction and spread to other bacterial species, respectively.
Acknowledgments
The authors are grateful to the staff of Duedu Laboratory and Laboratory Department of the HTH for their support.
Data Availability
Data are obtainable from the corresponding author upon satisfactory request.
Conflicts of Interest
The authors declare that they have no conflicts of interest.
Authors' Contributions
JGD, KOD, and PKF conceived the study. JGD drafted the proposal for ethical clearance. JGD collected samples and carried out laboratory analysis. KOD, GEK, and SK analyzed data. JGD drafted the manuscript. KOD, GEK, SK, and PKF revised the manuscript for intellectual content. KOD and PKF proof-read the manuscript. All authors read and approved the final manuscript.
References
- 1.Sulis G., Sayood S., Gandra S. Antimicrobial resistance in low- and middle-income countries: current status and future directions. Expert Review of Anti-infective Therapy . 2022;20(2):147–160. doi: 10.1080/14787210.2021.1951705. [DOI] [PubMed] [Google Scholar]
- 2.O’Neill J. Tackling Drug-Resistant Infections Globally: Final Report and Recommendations . London, UK: Review on Antimicrobial Resistance; 2016. [Google Scholar]
- 3.Nagaraj S., Chandran S., Shamanna P., Macaden R. Carbapenem resistance among Escherichia coli and Klebsiella pneumoniae in a tertiary care hospital in south India. Indian Journal of Medical Microbiology . 2012;30(1):93–95. doi: 10.4103/0255-0857.93054. [DOI] [PubMed] [Google Scholar]
- 4.Osei Sekyere J. Current state of resistance to antibiotics of last-resort in South Africa: a review from a public health perspective. Frontiers in Public Health . 2016;4:p. 209. doi: 10.3389/fpubh.2016.00209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Brink A. J., Coetzee J., Corcoran C., et al. Emergence of OXA-48 and OXA-181 carbapenemases among Enterobacteriaceae in South Africa and evidence of in vivo selection of colistin resistance as a consequence of selective decontamination of the gastrointestinal tract. Journal of Clinical Microbiology . 2013;51(1):369–372. doi: 10.1128/jcm.02234-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Jacobson R. K., Manesen M. R., Moodley C., et al. Molecular characterisation and epidemiological investigation of an outbreak of blaOXA-181 carbapenemase-producing isolates of Klebsiella pneumoniae in South Africa. South African medical journal . 2015;105(12):1030–1035. doi: 10.7196/SAMJ.2015.v105i12.9926. [DOI] [PubMed] [Google Scholar]
- 7.Brink A. J., Coetzee J., Clay C. G., et al. Emergence of New Delhi metallo-beta-lactamase (NDM-1) and Klebsiella pneumoniae carbapenemase (KPC-2) in South Africa. Journal of Clinical Microbiology . 2012;50(2):525–527. doi: 10.1128/jcm.05956-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Cornaglia G., Rossolini G. M. The emerging threat of acquired carbapenemases in gram-negative bacteria. Clinical Microbiology and Infections . 2010;16(2):99–101. doi: 10.1111/j.1469-0691.2009.03114.x. [DOI] [PubMed] [Google Scholar]
- 9.Stapleton P. D., Shannon K. P., French G. L. Carbapenem resistance in Escherichia coli associated with plasmid-determined CMY-4 β-lactamase production and loss of an outer membrane protein. Antimicrobial Agents and Chemotherapy . 1999;43(5):1206–1210. doi: 10.1128/aac.43.5.1206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Kempf I., Jouy E., Chauvin C. Colistin use and colistin resistance in bacteria from animals. International Journal of Antimicrobial Agents . 2016;48(6):598–606. doi: 10.1016/j.ijantimicag.2016.09.016. [DOI] [PubMed] [Google Scholar]
- 11.Rhouma M., Beaudry F., Letellier A. Resistance to colistin: what is the fate for this antibiotic in pig production? International Journal of Antimicrobial Agents . 2016;48(2):119–126. doi: 10.1016/j.ijantimicag.2016.04.008. [DOI] [PubMed] [Google Scholar]
- 12.Nordmann P., Poirel L. Plasmid-mediated colistin resistance: an additional antibiotic resistance menace. Clinical Microbiology and Infection . 2016;22(5):398–400. doi: 10.1016/j.cmi.2016.03.009. [DOI] [PubMed] [Google Scholar]
- 13.Montso K. P., Dlamini S. B., Kumar A., Ateba C. N. Antimicrobial resistance factors of extended-spectrum beta-lactamases producing Escherichia coli and Klebsiella pneumoniae isolated from cattle farms and raw beef in North-West province, South Africa. BioMed Research International . 2019;2019:13. doi: 10.1155/2019/4318306.4318306 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Deku J. G., Duedu K. O., Kinanyok S., Kpene G. E., Feglo P. K. Phylogenicity and virulence profiles of clinical Escherichia coli isolates in the Ho teaching hospital of Ghana. BioMed Research International . 2022;2022:8. doi: 10.1155/2022/1347033.1347033 [DOI] [Google Scholar]
- 15.van der Zwaluw K., de Haan A., Pluister G. N., Bootsma H. J., de Neeling A. J., Schouls L. M. The carbapenem inactivation method (CIM), a simple and low-cost alternative for the Carba NP test to assess phenotypic carbapenemase activity in gram-negative rods. PLoS One . 2015;10(3) doi: 10.1371/journal.pone.0123690.e0123690 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.CLSI. Performance Standards for Antimicrobial Susceptibility Testing. M100 . Wayne, PA, USA: CLSI; 2018. [Google Scholar]
- 17.Pierce V. M., Simner P. J., Lonsway D. R., et al. Modified carbapenem inactivation method for phenotypic detection of carbapenemase production among Enterobacteriaceae. Journal of Clinical Microbiology . 2017;55(8):2321–2333. doi: 10.1128/jcm.00193-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Yang F., Shen C., Zheng X., et al. Plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China. Infection and Drug Resistance . 2019;12:385–389. doi: 10.2147/idr.s194635. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li S., Duan X., Peng Y., Rui Y. Molecular characteristics of carbapenem-resistant Acinetobacter spp. from clinical infection samples and fecal survey samples in Southern China. BMC Infectious Diseases . 2019;19(1):900–912. doi: 10.1186/s12879-019-4423-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Rebelo A. R., Bortolaia V., Kjeldgaard J. S., et al. Multiplex PCR for detection of plasmid-mediated colistin resistance determinants, mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5 for surveillance purposes. European Communicable Disease Bulletin . 2018;23(6) doi: 10.2807/1560-7917.ES.2018.23.6.17-00672.00672 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Karuniawati A., Saharman Y. R., Lestari D. C. Detection of carbapenemase encoding genes in enterobacteriace, Pseudomonas aeruginosa, and acinetobacter baumanii isolated from patients at intensive care unit cipto mangunkusumo hospital in 2011. Acta Medica Indonesiana . 2013;45(2):101–106. [PubMed] [Google Scholar]
- 22.Mushi M. F., Mshana S. E., Imirzalioglu C., Bwanga F. Carbapenemase genes among multidrug resistant gram negative clinical isolates from a tertiary hospital in Mwanza, Tanzania. BioMed Research International . 2014;2014:6. doi: 10.1155/2014/303104.303104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Okoche D., Asiimwe B. B., Katabazi F. A., Kato L., Najjuka C. F. Prevalence and characterization of carbapenem-resistant Enterobacteriaceae isolated from mulago national referral hospital, Uganda. PLoS One . 2015;10(8) doi: 10.1371/journal.pone.0135745.e0135745 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Livermore D. M. Of Pseudomonas, porins, pumps and carbapenems. Journal of Antimicrobial Chemotherapy . 2001;47(3):247–250. doi: 10.1093/jac/47.3.247. [DOI] [PubMed] [Google Scholar]
- 25.Jacoby G. A., Mills D. M., Chow N. Role of β-lactamases and porins in resistance to ertapenem and other β-lactams in Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy . 2004;48(8):3203–3206. doi: 10.1128/aac.48.8.3203-3206.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.EL Wartiti M. A., Bahmani F.-Z., Elouennass M., Benouda A. Prevalence of carbapenemase-producing Enterobacteriaceae in a university hospital in rabat, Morocco: a 19-months prospective study. The International Arabic Journal of Antimicrobial Agents . 2012;2(3) [Google Scholar]
- 27.Yusuf I., Yusha’u M., Sharif A. A., et al. Detection of metallo betalactamases among gram negative bacterial isolates from murtala muhammad specialist hospital, kano and almadina hospital kaduna, Nigeria. Bayero Journal of Pure and Applied Sciences . 2012;5(2) [Google Scholar]
- 28.Friedman N. D., Carmeli Y., Walton A. L., Schwaber M. J. Carbapenem-resistant enterobacteriaceae: a strategic roadmap for infection control. Infection Control and Hospital Epidemiology . 2017;38(5):580–594. doi: 10.1017/ice.2017.42. [DOI] [PubMed] [Google Scholar]
- 29.Asthana S., Mathur P., Tak V. Detection of carbapenemase production in gram-negative bacteria. Journal of Laboratory Physicians . 2014;6(2):69–75. doi: 10.4103/0974-2727.141497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Otokunefor K., Tamunokuro E., Amadi A. Molecular detection of mobilized colistin resistance (mcr-1) gene in Escherichia coli isolates from Port Harcourt, Nigeria. Journal of Applied Sciences and Environmental Management . 2019;23(3):401–405. doi: 10.4314/jasem.v23i3.5. [DOI] [Google Scholar]
- 31.Zhong Y.-M., Liu W.-E., Zheng Z.-F. Epidemiology and molecular characterization of mcr-1 in Escherichia coli recovered from patients with bloodstream infections in Changsha, central China. Infection and Drug Resistance . 2019;12:2069–2076. doi: 10.2147/idr.s209877. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Luo Q., Yu W., Zhou K., et al. Molecular epidemiology and colistin resistant mechanism of mcr-positive and mcr-negative clinical isolated Escherichia coli. Frontiers in Microbiology . 2017;8 doi: 10.3389/fmicb.2017.02262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Saavedra S. Y., Diaz L., Wiesner M., et al. Genomic and molecular characterization of clinical isolates of Enterobacteriaceae harboring mcr-1 in Colombia, 2002 to 2016. Antimicrobial Agents and Chemotherapy . 2017;61(12) doi: 10.1128/AAC.00841-17.e00841 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Cao L., Li X., Xu Y., Shen J. Prevalence and molecular characteristics of mcr-1 colistin resistance in Escherichia coli: isolates of clinical infection from a Chinese University Hospital. Infection and Drug Resistance . 2018;11:1597–1603. doi: 10.2147/idr.s166726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Chan W. S., Au C. H., Ho D. N., Chan T. L., Ma E. S., Tang B. S. Prospective study on human fecal carriage of Enterobacteriaceae possessing mcr-1 and mcr-2 genes in a regional hospital in Hong Kong. BMC Infectious Diseases . 2018;18(1) doi: 10.1186/s12879-018-2987-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Eiamphungporn W., Yainoy S., Jumderm C., Tan-Arsuwongkul R., Tiengrim S., Thamlikitkul V. Prevalence of the colistin resistance gene mcr-1 in colistin-resistant Escherichia coli and Klebsiella pneumoniae isolated from humans in Thailand. Journal of Global Antimicrobial Resistance . 2018;15:32–35. doi: 10.1016/j.jgar.2018.06.007. [DOI] [PubMed] [Google Scholar]
- 37.Olowo-Okere A., Yacouba A. Molecular mechanisms of colistin resistance in Africa: a systematic review of literature. Germs . 2020;10(4):367–379. doi: 10.18683/germs.2020.1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Newton-Foot M., Snyman Y., Maloba M. R. B., Whitelaw A. C. Plasmid-mediated mcr-1 colistin resistance in Escherichia coli and Klebsiella spp. clinical isolates from the Western Cape region of South Africa. Antimicrobial Resistance and Infection Control . 2017;6(1):1–7. doi: 10.1186/s13756-017-0234-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Al-Tawfiq J. A., Laxminarayan R., Mendelson M. How should we respond to the emergence of plasmid-mediated colistin resistance in humans and animals? International Journal of Infectious Diseases . 2017;54:77–84. doi: 10.1016/j.ijid.2016.11.415. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Data are obtainable from the corresponding author upon satisfactory request.