Table 1.
Primer sets
| Primer Set | Forward | Reverse | Amplicon Size, bp |
|---|---|---|---|
| 1 | attggtctttgcttggtctc | tgccactccatatctaactg | 988 |
| 2 | ggggattggtctttgcttgg | ggatcccacctagcagaaaga | 676 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.