TABLE 1.
TM7-specific PCR primers and FISH probes and optimized conditions for use
| Oligonucleotide | E. coli no. | Sequence (5′-3′) | Length (nt) | Tm (°C)a | % GC content | Optimized conditions
|
|
|---|---|---|---|---|---|---|---|
| Annealing temp (°C)b | % Formamidec | ||||||
| Primers | |||||||
| TM7314F | 295–314 | GAGAGGATGATCAGCCAG | 20 | 54 | 50 | 60 | |
| TM7580F | 563–580 | AYTGGGCGTAAAGAGTTGC | 19 | 58 | 50 | 60 | |
| Probes | |||||||
| TM7305 | 305–322 | GTCCCAGTCTGGCTGATC | 18 | 56 | 61 | 30 | |
| TM7905 | 905–926 | CCGTCAATTCCTTTATGTTTTA | 22 | 56 | 32 | 20 | |
| TM7522 | 522–537 | CGTATGACCGCGGCTG | 16 | 61 | 69 | NA | |
| TM7567 | 567–585 | CCTACGCAACTCTTTACGCC | 20 | 60 | 55 | NA | |
Nearest-neighbor melting temperature.
Annealing temperature of PCR using 1492R as reverse primer.
46°C hybridization temperature and 48°C wash temperature. NA, not applicable (no specific hybridization signal was obtained).