TABLE 1.
Oligonucleotide probe and primers and PCR programs to amplify specific fragments from the various pathogenic genes in E. coli
| Oligonucleotide probe or PCR primer (orientation) | Target gene(s) | Sequence (5′-3′) | Reaction temp (°C)
|
Size of product (bp) | Reference | ||
|---|---|---|---|---|---|---|---|
| Denaturation | Annealing | Extension | |||||
| VT com (oligonucleotide probe)a | stx1 and stx2 | GAGCGAAATAATTTATATGTG | 34 | ||||
| VT com-u (forward) | stx1 and stx2 | GAGCGAAATAATTTATATGTG | 94 (45)b | 55 (45) | 72 (60) | 518 | 34 |
| VT com-d (reverse) | TGATGATGGCAATTCAGTAT | ||||||
| VT com-nesF (forward) | stx1 and stx2 | CGGACAGTAGTTATACCAC | 94 (30) | 55 (30) | 72 (45) | 171 | 34 |
| VT com-nesR (reverse) | CTGCTGTCACAGTGACAA | ||||||
| VT1a (forward) | stx1 | CAGTTAATGTGGTGGCGAAG | 94 (60) | 55 (60) | 72 (60) | 894 | 18 |
| VT1b (reverse) | CTGCTAATAGTTCTGCGCATG | ||||||
| VT2a (forward) | stx2 | CTTCGGTATCCTATTCCCGG | 94 (60) | 55 (60) | 72 (60) | 478 | 18 |
| VT2b (reverse) | GGATGCATCTCTGGTCATTG | ||||||
| BFP1 (forward) | bfp | GATTGAATCTGCAATGGTGC | 94 (60) | 57 (60) | 72 (60) | 597 | 30 |
| BFP2 (reverse) | GGATTACTGTCCTCACATAT | ||||||
| EAF1 (forward) | EAF plasmid | CAGGGTAAAAGAAAGATGATAA | 94 (60) | 57 (45) | 72 (60) | 399 | 8 |
| EAF25 (reverse) | TATGGGGACCATGTATTATCA | ||||||
| Ehly AF (forward) | EHEC-hlyA | GCATCATCAAGCGTACGTTCC | 94 (60) | 60 (120) | 72 (60) | 534 | 20 |
| Ehly AR (reverse) | AATGAGCCAAGCTGGTTAAGCT | ||||||
| eae-1 (forward) | eae | ACGTTGCAGCATGGGTAACTC | 94 (60) | 55 (60) | 72 (60) | 815 | 10 |
| eae-2 (reverse) | GATCGGCAACAGTTTCACCTG | ||||||
| Int-α (forward) | eae | CCTTAGGTAAGTTAAGT | 95 (45) | 45 (60) | 72 (60) | 557 | 1 |
| Int-Ru (reverse) | TTTATTTGCAGCCCCCCAT | ||||||
| Int-αR (reverse) | TGACTAGACTTATTATATTCc | 588 | This study | ||||
| Int-β (forward) | eae | TAAGGATTTTGGGACCC | 95 (60) | 45 (60) | 72 (60) | 563 | 1 |
| Int-Ru (reverse) | TTTATTTGCAGCCCCCCAT | ||||||
| Int-γ (forward) | eae | ACAAACTTTGGGATGTTC | 95 (45) | 55 (60) | 72 (60) | 542 | 1 |
| Int-Ru (reverse) | TTTATTTGCAGCCCCCCAT | ||||||
| Int-γR (reverse) | AGTTCATAGAACTATAATGGCc | 571 | This study | ||||
| Int-δ (forward) | eae | TACGGATTTTGGGGCAT | 95 (45) | 45 (60) | 72 (60) | 563 | 1 |
| Int-Ru (reverse) | TTTATTTGCAGCCCCCCAT | ||||||
| SK-1 (forward) | eaed | CCCGAATTCGGGACAAGCATAAGC | 94 (45) | 65 (45) | 72 (120) | 2,608 | 19 |
| LP-5 (reverse) | AGCTCACTCGTAGATGACGGCAAGCG | ||||||
| ESPA-F (forward) | espA | ACTCGGTGTTTTTCAGGCTGC | 94 (40) | 53 (45) | 72 (60) | 445e | This study |
| ESPA-R (reverse) | TGAAATAGTTCTATATTG | ||||||
| ESPB-F (forward) | espB | GCCGTTTTTGAGAGCCAGAAT | 94 (40) | 63 (45) | 72 (60) | 633e | This study |
| ESPB-R (reverse) | ATCATCCTGCGCTCTGCGAAC | ||||||
| ESPD-F (forward) | espD | CGCTGGATTTACAACTGGTTA | 94 (40) | 60 (45) | 72 (60) | 939f | This study |
| ESPD-R (reverse) | CCAGCTCAACCTTCGCACTCT | ||||||
| TIR-F (forward) | tir | CATTACCTTCACAAACCGAC | 94 (40) | 57 (60) | 72 (75) | 1,550g | This study |
| TIR-R (reverse) | CCCCGTTAATCCTCCCAT | ||||||
The oligonucleotide probe is specific for each stx variant, and an alkaline phosphatase was labeled at the 5′ end of an oligonucleotide molecule. Hybridization was performed at 50°C.
The value in parentheses is the reaction time (in seconds).
Improved PCR primer.
Primers SK-1 and LP-5 are specific for intimin variant ɛ.
Product size when E. coli E2348/69 DNA (National Center for Biotechnology Information accession no. AF022236) was used as the template.
Product size when E. coli DA-EPEC-B6 DNA (National Center for Biotechnology Information accession no. Y17875) was used as the template.
Product size when E. coli 955F2 DNA (National Center for Biotechnology Information accession no. AF070067.1) was used as the template.