Table 2.
Primer pairs used for BRV detection and sequencing.
| Primer | Sequence 5′ to 3′ | Annealing T, °C | Length, bp | Purpose in Research | Reference |
|---|---|---|---|---|---|
| P1/P2 | GTAATACGCTGGTGTCTC/ GAAAGGACATTTCAGCTC |
49 | 215 | For detection of RNA2 plants | [15] |
| P5/P6 | AAACCAGACCCAGGTGAGTG/GGACACTTCCATATAAGTCGGC | 60 | 481 | For detection of RNA2 in plants and inoculum | [31] |
| BCP11/P6 | ATTTCGAGCTGTATGGTCG/CTCGGAAGCAGTAGACCT | 51 | 787 | For detection of RNA2 in inoculum | [15] |
| BCP11/P2 | ATTTCGAGCTGTATGGTCG/GAAAGGACATTTCAGACTC | 51 | ~1449 | For sequencing and genetic analysis of RNA2 | [15] |