|
Antibodies
|
| ARAF |
Santa Cruz |
sc-408 (AB_630882) |
| BRAF |
Santa Cruz |
sc-5284 (AB_626760) |
| BRAF |
Sigma |
HPA001328 (AB_1078296) |
| CRAF |
BD |
610152 (AB_397553) |
| FLAG |
Sigma |
F1804 (AB_262044) |
| V5 |
Thermo Fisher |
R960-25 (AB_2556564) |
| GAPDH |
Santa Cruz |
sc-32233 (AB_627679) |
| RAS |
Thermo Fisher |
MA1-012 (AB_2536664) |
| RAS |
Santa Cruz |
sc-14022 (not available) |
| RAS |
Millipore |
05-516 (AB_11211664) |
| NF1 |
Santa Cruz |
sc-67 (AB_2149681) |
| Cyclin D1 |
Santa Cruz |
sc-718 (AB_2070436) |
| Sprouty2 |
Abcam |
ab85670 (not available) |
| p-MEK1/2 (Ser217/221)) |
Cell Signaling |
9154 (AB_2138017) |
| MEK1/2 |
Cell Signaling |
4694 (AB_10695868) |
| p-p44/42 MAPK (Erk1/2) |
Cell Signaling |
9101 (AB_331646) |
| p44/42 MAPK (Erk1/2) |
Cell Signaling |
4696 (AB_390780) |
| p-EGFR (Tyr1068) |
Cell Signaling |
3777 (AB_2096270) |
| EGFR |
Cell Signaling |
4267 (AB_2246311) |
| p-TrkA |
Cell Signaling |
4619 (AB_10235585) |
| AKT |
Cell Signaling |
9272 (AB_329827) |
| p-AKT (Ser473) |
Cell Signaling |
4060 (AB_2315049) |
| p-AKT (Ser308) |
Cell Signaling |
4056 (AB_331163) |
|
Chemicals, peptides and recombinant proteins
|
| DMEM |
ThermoFisher Scientific |
11965-092 |
| RPMI 1640 |
ThermoFisher Scientific |
61870-036 |
| DMEM/F12 |
ThermoFisher Scientific |
12634-010 |
| Renaissance Essential Tumor Medium |
Cellaria |
CM-0001 |
| B27 supplement |
ThermoFisher Scientific |
17504044 |
| Matrigel |
Corning |
354234 |
| L-glutamine |
Corning |
25005CI |
| penicillin G-streptomycin |
Corning |
30004CI |
| Trypsin-EDTA (0.05%) |
Invitrogen |
25300054 |
| TrypLE Express |
Invitrogen |
12604013 |
| CD45 MicroBeads, human |
Miltenyl Biotex |
130-045-801 |
| Doxycycline |
Sigma |
D3072 |
| 4-OHT |
Sigma |
H6278 |
| Erlotinib |
MedChem Express |
HY-50896 |
| Osimertinib |
Selleckchem |
S7297 |
| Puromycin |
Invitrogen |
A1113802 |
| hygromycin |
Invitrogen |
10687010 |
| Blasticidin |
Invitrogen |
A1113903 |
| SHP099 |
Novartis |
N/A |
| Recombinant human ARAF |
Origene |
TP300737 |
| Recombinant human BRAF |
Origene |
TP311013 |
| Recombinant human CRAF |
Origene |
TP301983 |
| Recombinant human NF1-333 |
Creative Biomart |
NF1-334H |
| Recombinant human EGF |
Invitrogen |
PHG0311 |
| Recombinant rat NGF |
R & D |
7185-NG-025 |
| Recombinant human KRAS |
Origene |
TP301958 |
| Recombinant human NRAS |
Cell Biolabs |
STA-749 |
| Recombinant human HRAS |
Cell Biolabs |
STA-747 |
| Recombinant K97R MEK |
Millipore |
14-737 |
|
Critical commercial assays
|
| CellTiter-Glow |
Promega |
G7573 |
| CellTiter-Glow 3D |
Promega |
G9682 |
| Active RAS pull-down assay |
ThermoFisher Scientific |
16117 |
| GTPase-Glow assay |
Promega |
V7681 |
|
Experimental models: Organisms/strains
|
| Athymic nude mice (female) |
Envigo |
Hsd:Athymic Nude-Foxn1nu
|
| Nod SCID gamma mice (female) |
The Jackson Laboratory |
005557 |
|
Experimental models: cell lines
|
| 293FT (human) |
ThermoFisher Scientific |
R70007 (CVCL_6911) |
| NIH 3T3 (mouse) |
ATCC |
CRL-1658 (CVCL-0594) |
| SKBR3 (human) |
ATCC |
HTB-30 (CVCL_0033) |
| PC9 (human) |
Sigma |
90071810 (CVCL_B260) |
| HCC827 (human) |
ATCC |
CRL-2868 (CVCL_2063) |
| LIM1215 (human) |
Sigma |
10092301 (CVCL_2574) |
| BT474 (human) |
ATCC |
CRL-3247 (CVCL_AQ07) |
| H1703 (human) |
ATCC |
CRL-5889 (CVCL_1490) |
| A549 (human) |
ATCC |
CCL-185 (CVCL_0023) |
| H23 (human) |
ATCC |
CRL-5800 (CVCL_1547) |
| PC12 Tet-On (rat) |
Clonetech |
631137 (CVCL_V333) |
| SK-Mel2 (human) |
MSKCC |
(CVCL_0069) |
| SK-Mel30 (human) |
MSKCC |
(CVCL_0039) |
| K-Raslox MEF (mouse) |
Mariano Barbacid |
doi: 10.1073/pnas.1417549111. |
| RAF-less MEF (mouse) |
Mariano Barbacid |
doi: 10.1073/pnas.1417549111. |
| MEK-less MEF (mouse) |
Mariano Barbacid |
doi: 10.1073/pnas.1417549111. |
| ARAF knockout MEF (mouse) |
Manuela Baccarini |
N/A |
| BRAF knockout MEF (mouse) |
Manuela Baccarini |
N/A |
| CRAF knockout MEF (mouse) |
Manuela Baccarini |
N/A |
| YUMM 4.1 (mouse) |
Marcus Bosenberg |
doi: 10.1111/pcmr.12498. |
|
Oligonucleotides
|
| Human ARAF siRNA |
Dharmacon |
L-003563-00-0020 |
| Human BRAF siRNA |
Dharmacon |
L-003460-00-0020 |
| Human CRAF siRNA |
Dharmacon |
L-003601-00-0020 |
| Rat ARAF siRNA |
Dharmacon |
L-088540-00-0020 |
| Mouse ARAF siRNA |
Dharmacon |
L-042948-00-0020 |
| Mouse BRAF siRNA |
Dharmacon |
L-040325-00-0020 |
| Mouse CRAF siRNA |
Dharmacon |
L-040149-00-0020 |
| Human ARAF shRNA1 |
Sigma |
TRCN0000000571 |
| Human ARAF shRNA2 |
Sigma |
TRCN0000199465 |
| NF1 sgRNA1 |
Cellecta |
CATGAGACCACTGTCTACGT |
| NF1 sgRNA2 |
Cellecta |
CCACCACCTAGAATCGAAAG |
| NF1 sgRNA3 |
Cellecta |
GAGGAAGCAGATATCCGGTG |
| Cyclin D1 qPCR probe |
ThermoFisher Scientific |
Mm00432359_m1 |
| DUSP4 qPCR probe |
ThermoFisher Scientific |
Mm00732761_m1 |
| DUSP6 qPCR probe |
ThermoFisher Scientific |
Mm00518185_m1 |
| SPRY2 qPCR probe |
ThermoFisher Scientific |
Mm00442344_m1 |
| SPRY4 qPCR probe |
ThermoFisher Scientific |
Mm00442345_m1 |
| ETV1 qPCR probe |
ThermoFisher Scientific |
Mm00514804_m1 |
| GAPDH qPCR probe |
ThermoFisher Scientific |
Mm99999915_g1 |
|
Recombinant DNA
|
| pcDNA3.1-hARAF-V5 |
This paper |
N/A |
| pcDNA3.1-hBRAF-V5 |
This paper |
N/A |
| pcDNA3.1-hCRAF-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214A-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214C-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214F-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214T-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-R362H-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-R52L-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214A-R362H-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214C-R362H-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214F-R362H-V5 |
This paper |
N/A |
| pcDNA3.1-hARAF-S214T-R362H-V5 |
This paper |
N/A |
| pcDNA3.1-hBRAF-S365A-V5 |
This paper |
N/A |
| pcDNA3.1-hBRAF-S365C-V5 |
This paper |
N/A |
| pcDNA3.1-hBRAF-R509H-V5 |
This paper |
N/A |
| pcDNA3.1-hBRAF-S365C-R509H-V5 |
This paper |
N/A |
| pcDNA3.1-hCRAF-R401A-V5 |
This paper |
N/A |
| pcDNA3.1-hCRAF-S259A-V5 |
This paper |
N/A |
| pcDNA3.1-hCRAF-S259A-R401H-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-V5 |
This paper |
N/A |
| pTTIGFP-hBRAF-V5 |
This paper |
N/A |
| pTTIGFP-hCRAF-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214A-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214C-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214F-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214T-V5 |
This paper |
N/A |
| pTTIGFP-hBRAF-K601E-V5 |
This paper |
N/A |
| pTTIGFP-hCRAF-S259A-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-R52L-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-D429A-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-R362H-V5 |
This paper |
N/A |
| pTTIGFP-BN-ARAF-V5 |
This paper |
N/A |
| pTTIGFP-CN-ARAF-V5 |
This paper |
N/A |
| pTTIGFP-NoN-ARAF-V5 |
This paper |
N/A |
| pTTIGFP-NoN-BRAF-V5 |
This paper |
N/A |
| pTTIGFP-AN-BRAF-V5 |
This paper |
N/A |
| pTTIGFP-NoN-CRAF-V5 |
This paper |
N/A |
| pTTIGFP-AN-CRAF-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214A-R52L-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214C-R52L-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214F-R52L-V5 |
This paper |
N/A |
| pTTIGFP-hARAF-S214T-R52L-V5 |
This paper |
N/A |
| pXretro-FLAG-NRAS |
This paper |
N/A |
| pXretro-FLAG-HRAS |
This paper |
N/A |
| pXretro-FLAG-KRAS |
This paper |
N/A |
| pMSCV-rtTA3-PGK-Hygro |
Scott Lowe |
N/A |
| TTIGFP-MLUEX |
Scott Lowe |
N/A |
| pEF-DEST51-NF1-V5-His |
Frank McCormick |
N/A |
|
Deposited data
|
| Raw western blot and microscopy data |
Mendeley |
doi: 10.17632/yx7s86mcrn.1
|
|
Software and algorithms
|
| ImageJ |
NIH |
https://imagej.nih.gov/ij/
|
| GraphPad Prism 8 |
GraphPad Software |
https://www.graphpad.com
|
