Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers and probe sequences used for SARS-CoV-2 quantification.
| Oligonucleotide | Sequence (5’ à 3’) | Length (bp) | Ta (°C) | Amplicon size (positions in reference genome) |
|---|---|---|---|---|
| Forward primer | TCATCACGTAGTCGCAACAG | 20 | 62.9 | 82 bp (28,832-28,913) |
| Reverse primer | CATTGCCAGCCATTCTAGCA | 20 | 63.9 | |
| Labeled Probea | CAAGAAATTCAACTCCAGGCAGCAGTA | 27 | 67.7 |
.- /56-FAM/CAAGAAATT/ZEN/CAACTCCAGGCAGCAGTA/3IABkFQ/ double-quenched probe.
bp: base pair.
