| Antibodies |
| Rat anti-Ms Ly6G (FITC) |
BD |
Cat#551460; clone 1A8; Lot#6033810 |
| Rat anti-Ms CD4 (FITC) |
BD |
Cat#553729; clone GK1.5; Lot#5191688 |
| Hamster anti-Ms TCRbeta (BUV737) |
BD |
Cat#612821; clone H57-597; Lot#9331214 |
| Rat anti-Ms CD45 (APC-Cy7) |
BD |
Cat#557659; clone 30-F11; Lot#5357842 |
| Hamster anti-Ms CD3e (Pacific Blue) |
BD |
Cat#558214; clone 500-A2; Lot#5009871 |
| Rat anti-Ms IL-17A (AF647) |
BD |
Cat#560184; clone TC11-18H10; Lot#7104724 |
| Rat anti-Ms I-A/I-E (BV605) |
BD |
Cat#563413; clone M5/114.15.2; Lot#5170799 |
| Rat anti-CD11b (BUV395) |
BD |
Cat#565976; RRID AB_2738276 |
| Rat anti-Ms/Hu CD45R/B220 (BV711) |
BioLegend |
Cat#103255; clone RA3-6B2; Lot#B223589 |
| Goat anti-Ms IgG (AF647) |
BioLegend |
Cat#405322; RRID AB_2563045; Lot#B246161 |
| Rat anti-Ms IgA (PE) |
eBioscience / Thermo Fisher Scientific |
Cat#12420482; clone mA-6E1; Lot#2173312 |
| Rat anti-Ms CD16/32 |
eBioscience / Thermo Fisher Scientific |
Cat#14016186; clone 93; Lot#4333612 |
| Hamster anti-Ms/Hu CD11c (AF700) |
eBioscience / Thermo Fisher Scientific |
Cat#56011480; clone N418; Lot#E089601632 |
| LIVE/DEAD Fixable Blue Dead Cell Stain Kit, for UV excitation |
Thermo Fisher Scientific |
Cat#L23105
|
| Goat anti-Ms IgG (H+L) (HRP) |
Thermo Fisher Scientific |
Cat#31430; Lot#UB278606 |
| Goat anti-Ms IgA (HRP) |
Sigma Aldrich |
Cat#A4789 |
| Bacterial and Virus Strains |
|
Bacteroides sp.
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0582 |
|
Parabacteroides distasonis
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0583 |
|
Peptoniphilus sp.
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0584 |
|
Bacteroides ovatus
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0585 |
| order Clostridiales UC |
Palm & de Zoete, et al. Cell 2014. |
NWP_0586 |
| family Lachnospiraceae UC |
Palm & de Zoete, et al. Cell 2014. |
NWP_0587 |
|
Collinsella stercoris
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0588 |
|
Bacteroides uniformis
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0589 |
|
Parabacteroides sp.
|
Palm & de Zoete, et al. Cell 2014. |
NWP_0590 |
|
Allobaculum sp. 128 |
Palm & de Zoete, et al. Cell 2014. |
NWP_0324 |
|
Allobaculum sp. Allo2 |
this paper |
NWP_0593 |
|
Akkermansia muciniphila
|
Derrien, et al. 2004
|
ATCC BAA-835 |
|
Akkermansia muciniphila 2G4 |
this paper |
NWP_0598 |
| Chemicals, Peptides, and Recombinant Proteins |
| Gifu Anaerobic Media |
HyServe |
Cat#05422 |
| Gut Microbiota Media (GMM) |
Goodman, et al. 2011
|
N/A |
| Dextran Sodium Sulfate (DSS) |
TdB Labs
|
Cat#DB001 |
| Bouin’s Fixative Solution |
Fisher Scientific |
Cat#11201 |
| TRI Reagent |
Sigma Aldrich |
Cat#T9424 |
| TMB Substrate Kit |
Thermo Fisher Scientific |
Cat#34021 |
| Sulfuric Acid, 2.0 N |
Avantor |
Cat#H381-05 |
| RPMI 1640 |
Thermo Fisher Scientific |
Cat#11875-119 |
| DNase I, bovine pancreas |
Sigma Aldrich |
Cat#10104159001 |
| Collagenase D (type IV) |
Sigma Aldrich |
Cat#11088882001 |
| Percoll |
VWR |
Cat#89428-524 |
| Phorbol-12-myristate-13-acetate (PMA) |
Sigma Aldrich |
Cat#P1585-1MG |
| Ionomycin Calcium salt, ready made |
Sigma Aldrich |
Cat#I3909-1ML |
| GolgiStop Protein Transport Inhibitor |
BD |
Cat#554724 |
| Critical Commercial Assays |
| MagAttract Microbial DNA Kit (384) |
Qiagen |
Cat#27200-4 |
| PCR Purification Kit, Agencourt AMPure XP |
Beckman Coulter |
Cat#A63881 |
| NGS Library Quantification Complete kit (ABI Prism) |
KAPA Biosystems |
Cat#KK4835 |
| MiSeq Reagent Kit v2 (500 cycles) |
Illumina |
Cat#MS-102-2003 |
| Mouse Lipocalin-2/NGAL DuoSet ELISA |
R&D Systems |
Cat#DY1857 |
| Bioanalyzer RNA 6000 Nano Kit |
Agilent |
Cat#5067-1511 |
| ZymoBIOMICS Spike-in Control I (High Microbial Load) |
Zymo Research |
Cat#D6320 |
| Stranded Total RNA Prep kit for RNAseq libraries |
Illumina |
Cat#20040529 |
| Wet-to-Digital H&E histology services |
Histowiz
|
N/A |
| Deposited Data |
| Allobaculum sp. 128 whole genome sequence |
NCBI Genbank |
CP078089
|
| Allobaculum sp. 'Allo2' whole genome sequence |
NCBI Genbank |
CP078088
|
| Bulk colon RNAseq |
NCBI Bioproject |
PRJNA739762
|
| Bulk intestinal epithelial RNAseq |
NCBI Bioproject |
PRJNA739762
|
| Bulk microbial RNAseq |
NCBI Bioproject |
PRJNA739762
|
| MLN & PP single cell RNAseq |
NCBI GEO |
GSE179165
|
| Experimental Models: Organisms/Strains |
| Germ-free C57BL/6 mice |
University of Chicago Animal Resources Center |
N/A |
| Germ-free Il10−/− mice |
University of Michigan Gnotobiotics
|
N/A |
| Germ-free Rag1-/-
|
University of Michigan Gnotobiotics
|
N/A |
| Oligonucleotides |
| EUB-338 (FISH) |
Canny, et al. 2006. |
[Cy3]-5’-GCTGCCTCCCGTAGGAGT-3’-[Cy3] |
| VP403 (FISH) |
Arnds, et al. 2010
|
[biotin]-5’-CGAAGACCTTATCCTCCACG-3’-[biotin] |
| Hprt_qpcr_F |
this paper |
TCAGTCAACGGGGGACATAAA |
| Hprt_qpcr_R |
this paper |
GGGGCTGTACTGCTTAACCAG |
| Saa1_qpcr_F |
this paper |
TCTGGAGTTTTCCCAAGGGTG |
| Saa1_qpcr_R |
this paper |
GGTGAGTAGCTTCATCCTCTGTC |
| Saa3_qpcr_F |
this paper |
TGAAAGAAGCTGGTCAAGGGTC |
| Saa3_qpcr_R |
this paper |
TCCCCCGAGCATGGAAGTAT |
| Reg3b_qpcr_F |
this paper |
ATACCCTCCGCACGCATTAG |
| Reg3b_qpcr_R |
this paper |
TCTTTTGGCAGGCCAGTTCT |
| Software and Algorithms |
| GraphPad Prism |
https://www.graphpad.com/scientific-software/prism/
|
v9 |
| QIIME |
http://qiime.org/
|
v1.9 |
| MEGA |
https://www.megasoftware.net/
|
v10.2.6 |
| FlowJo |
Treestar |
v10 |
| Partek Flow |
https://www.partek.com/partek-flow/
|
v6 |
| Panther |
http://geneontology.org/
|
v14 |
| Seurat |
https://satijalab.org/seurat/index.html
|
v3.2.1 |
| Immunarch |
https://immunarch.com/
|
v0.6.6 |
| R |
https://www.r-project.org/
|
v4.0.3 |
| Other |
| Anaerobic Culture Chambers |
Coy |
N/A |
| Flexible Film Gnotobiotic Isolators |
Class Biologically Clean |
N/A |
| Isocage P Microisolator Caging System |
Techniplast |
Cat#ISO72P |
| Bead Beater |
Biospec
|
N/A |
| Spectramax i3x plate reader |
Molecular Devices |
Cat#i3x |
| QuantStudio 6 Flex Real-Time PCR Instrument |
Applied Biosystems |
Cat#4485699 |
