KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| APC anti-mouse IL-18Ra (clone: A17071D) | Thermo Fisher Scientific | Cat# 157905, RRID:AB_2860734 |
| Alexa Fluor 700 anti-mouse CD4 (clone: RM4–5) | BD Biosciences | Cat# 557956, RRID:AB_396956 |
| APC anti-mouse IFNg (clone: XMG1.2) | Thermo Fisher Scientific | Cat# 25-7311-82, RRID:AB_469680 |
| BV605 anti-mouse CD8a (clone: 53–6.7) | BioLegend | Cat# 100744, RRID:AB_2562609 |
| BV711 anti-mouse CD8b (clone: H35–17.2) | BD Biosciences | Cat# 740761, RRID:AB_2740424 |
| APC anti-mouse CD8b (clone: H35–17.2) | Thermo Fisher Scientific | Cat# 17-0083-81, RRID:AB_657760 |
| PE-Cy7 anti-mouse CD45 (clone: 30-F11) | Thermo Fisher Scientific | Cat# 25-0451-82, RRID:AB_2734986 |
| eFluor 450 anti-mouse granzyme B (clone: NGZB) | Thermo Fisher Scientific | Cat# 48-8898-82, RRID:AB_11149362 |
| BV421 anti-mouse CD103 (clone: 2E7) | BioLegend | Cat# 121421, RRID:AB_10900074 |
| eFluor 450 anti-mouse CD62L (clone: MEL-14) | Thermo Fisher Scientific | Cat# 48-0621-82, RRID:AB_1963590 |
| FITC anti-mouse CD69 (clone: AB_465120) | Thermo Fisher Scientific | Cat# 11-0691-85, RRID:AB_1134101 |
| APC anti-mouse TCRb (clone: H57–597) | Thermo Fisher Scientific | Cat# 17-5961-83, RRID:AB_469482 |
| APCef780 anti-mouse TCRb (clone: H57–597) | Thermo Fisher Scientific | Cat# 47-5961-82, RRID:AB_1272173 |
| PerCP-eFluor710 anti-mouse TCRgd (clone: GL-3, GL3) | Thermo Fisher Scientific | Cat# 46-5711-82, RRID:AB_2016707 |
| BV421 anti-mouse CCR9 (clone: CW-1.2) | BD Biosciences | Cat#: 565412 RRID: AB_2739223 |
| FITC anti-mouse Ly6A (clone: D7) | Biolegend | Cat# 108106, RRID:AB_313342 |
| Alexa Fluor 647 anti-mouse CD244.2 (clone: eBio244F4) | Thermo Fisher Scientific | Cat# 51-2441-82, RRID:AB_657870 |
| V450 anti-mouse/human Tbet (clone: O4–46) | BD Biosciences | Cat#: 561312 RRID:AB_10611714 |
| APC anti-mouse CD5 (clone: 53–7.3) | Thermo Fisher Scientific | Cat#: 17-0051-81 RRID: AB_469330 |
| Aqua fluorescent reactive dye | TheromoFisher Scientific | Cat# 34966 |
| PE or APC TL (T3b) Tetramer | NIH tetramer facility | Not applicable |
| PE or APC LLO Tetramer | NIH tetramer facility | Not applicable |
| Anti-mouse IFNg (clone: XMG1.2) | BioXcell | Cat#: BE0055 RRID: AB_1107694 |
| Anti-mouse IL-18 (clone: YIGIF74–1G7) | BioXcell | Cat#: BE0237 RRID: AB_2687719 |
| Rat IgG1 (clone: HRPN) | BioXCell | Cat#: BE0088 RRID: AB_1107775 |
| Rat IgG2a (clone: 2A3) | BioxCell | Cat#: BE0089 RRID: AB_1107769 |
| Bacterial and Virus Strains | ||
| Murine Adenovirus-2 | Provided by J. Smith | Wilson et al., 2017 |
| Listeria monocytogenes 10403S-inlA expressing full length OVA | Provided by L. Lefrançois | Sheridan et al., 2014 |
| Reovirus T1L | Provided by B. Jabri | Bouziat et al., 2017 |
| Murine norovirus CW3 | Provided by K. Cadwell | Kernbauer et al, 2014 |
| Murine norovirus CR6 | Provided by K. Cadwell | Kernbauer et al, 2014 |
| Murine Adenovirus-2-GFP | Provided by J. Smith | Wilson et al., 2017 |
| Biological Samples | ||
| Chemicals, Peptides, and Recombinant Proteins | ||
| Tamoxifen | Sigma-Aldrich | Cat# T5648 |
| Ionomycin | Sigma-Aldrich | Cat# I0634 |
| GolgiStop with Monensin | BD Biosciences | Cat# 554724 |
| Dithiothreitol (DTT) | Sigma-Aldrich | Cat# 10197777001 |
| Phorbol 12-myristate 13-acetate (PMA) | Sigma-Aldrich | Cat#: P8139 |
| EDTA | ThermoFisher Scientific | Cat# AM9260G |
| Percoll | GE Healthcare | Cat# 17-0891-01 |
| Streptomycin Sulphate | MP Biomedicals | Cat# 0219454125 |
| Oxford Listeria selective agar base | Sigma Aldrich | Cat# 1070040500 |
| Oxford Listeria selective supplement | Sigma Aldrich | Cat# 1070060010 |
| TCL buffer | Qiagen | Cat# 1031576 |
| RNAClean XP beads | Agentcourt | Cat# A63987 |
| Maxima H- reverse transcriptase (RT) | ThermoFisher Scientific | Cat# EP0751 |
| Betaine Solution | Millipore Sigma | Cat# B0300 |
| RNAsin Plus RNase Inhibitor | ThermoFisher Scientific | Cat# PRN2615 |
| CytoFix/CytoPerm Fixation/Permeabilization Solution Kit | BD Biosciences | Cat# 554714 |
| Saponin | Sigma Aldrich | Cat# 47036 |
| RPMI 1650 | Gibco | Cat# 21870076 |
| Fetal Bovine Serum | Sigma | Cat# F0926 |
| Pen/Strep | Gibco | Cat# 10378016 |
| L-glutamine | Gibco | Cat# 25030–081 |
| Sodium Pyruvate | Gibco | Cat# 11360070 |
| Non-essential amino acids | Gibco | Cat# 11140050 |
| 2-mercaptoethanol | Sigma | Cat# M3148 |
| HEPES | Gibco | Cat# 15630–080 |
| Corn Oil | Sigma-Aldrich | Cat# C8267 |
| R-spondin | R&D | Cat# 4645-RS |
| Noggin | Peprotech | Cat# 250–38 |
| EGF | Peprotech | Cat# 315–09 |
| IL-2 | R&D | Cat# 402-ML |
| IL-15 complex | ThermoFisher Scientific | Cat# 16-8156-82 |
| IL-7 | R&D | Cat# 407-ML |
| IL-18 | R&D | Cat# 9124-IL |
| IFN-g | R&D | Cat# 485-MI |
| Matrigel | ThermoFisher Scientific | Cat# CB40230A |
| Critical Commercial Assays | ||
| eBioscience™ Foxp3 / Transcription Factor Staining Buffer Set | Thermo Fisher Scientific | Cat# 00-5523-00 |
| LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit | Thermo Fisher Scientific | Cat# L34966 |
| Miseq Reagent Kit v2 (500 cycles) | Illumina | Cat# MS-103–1003 |
| Nextera XT DNA Library Preparation Kit (24 samples) | Illumina | Cat# FC-131–1024 |
| QIAamp Fast DNA Stool Mini Kit | Qiagen | Cat# 51604 |
| PowerSYBR Green | Applied Biosystems | Cat# 4368577 |
| IFN-γ ELISA | Thermo Fisher Scientific | Cat# 88-7314-88 |
| IL-18 ELISA | Thermo Fisher Scientific | Cat# 88-50618-88 |
| Deposited Data | ||
| Bulk RNA-Seq | This paper | GEO: GSE196417 |
| Single cell TCR seq | This paper | GEO: GSE196417 |
| Experimental Models: Cell Lines | ||
| Experimental Models: Organisms/Strains | ||
| Mouse: Sell-CreER | Provided by M. Nuzzensweig | Merkenschlager et al., 2021 |
| Mouse: B6.129S2-H2dlAb1-Ea/J | Jackson Laboratory | Jax: 003584 |
| Mouse: ThpokeGFP: B6.129P2(Cg)-Zbtb7btm2Litt/J | Jackson Laboratory | Jax: 027663 |
| Mouse: Rosa26lsl-tdTomato: B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato) Hze/J | Jackson Laboratory | Jax: 007914 |
| Mouse: Tracf/f | Provided by A. Rudensky, (MSKCC) | Bilate et al., 2020 |
| Mouse: Runx3f/f | Jackson Laboratory | Jax: 008773 |
| Mouse: Tbx21f/f | Jackson Laboratory | Jax: 022741 |
| Mouse: Zbtb7bf/f | Jackson Laboratory | Jax: 009369 |
| Mouse: Ifngr1−/− | Jackson Laboratory | Jax: 003288 |
| Oligonucleotides | ||
| Biotinylated-T22VN used for Bulk RNAseq RT/cDNA synthesis: 5’- Bio-TTTTTTTTTTTTTTTTTTTTTTVN - 3’ | Integrated DNA Technologies | Not applicable |
| All TCR and barcode primers used for scTCRseq are found in Table S1. | Integrated DNA Technologies | Bilate et al., 2020 |
| Paired-end (PE) P1 used for scTCRseq by Miseq 5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ | Integrated DNA Technologies | Han et al., 2014 |
| PE P2 used for scTCRseq by Miseq 5’-AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT -3’ | Integrated DNA Technologies | Han et al., 2014 |
| Adenovirus FW 5’-GTCCGATTCGGTACTACGGT-3’ | Integrated DNA Technologies | Gounder, A.P et al., 2016 |
| Adenovirus RV 5’-GTCAGACAACTTCCCAGGGT-3’ | Integrated DNA Technologies | Gounder, A.P et al., 2016 |
| Recombinant DNA | ||
| Software and Algorithms | ||
| GraphPad Prism 9.0 | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| FlowJo v 10 | BD Biosciences | https://www.flowio.com/solutions/flowio |
| FACSDiva | BD Biosciences | https://www.bdbiosciences.com/en-us/instruments/research-instruments/research-software/flow-cytometry-acquisition/facsdiva-software |
| IMGT | Brochet et al., 2008 | imgt.org/HighV-QUEST |
| R | Not applicable | https://cran.r-project.org/ |
| PANDASEQ | Masella et al., 2012 | https://github.com/neufeld/pandaseq |
| sleuth (v0.30) package for R | Pimentel et al., 2017 | https://github.com/pachterlab/sleuth |
| kallisto (v0.46) software | Bray et al., 2016 | https://github.com/pachterlab/kallisto |
| Immunarch (v0.6.5) package | Not applicable | 10.5281/zenodo.3893991) |
| ImageJ | Not applicable | https://imagej.nih.gov/ij/ |
| TrackMate 6.0.2 | Tinevez et al., 2017 | https://imagej.net/plugins/trackmate/ |
| QuantStudio 3 RT PCR System | Applied Biosystems | https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-instruments/quantstudio-systems.html |
| Other | ||