| Antibodies |
|
|
|
| See Table S2 for CyTOF reagents |
This paper |
N/A |
| Anti-PD-1 (GNE9899) |
This paper |
N/A |
| Anti-PD-1 (Pembrolizumab) |
Selleck Chemicals |
Cat#: A2005 |
| Anti-TIGIT (10A7) |
Yu et al., 2009
|
N/A |
| CD226 blocking antibody (DX11) |
GeneTex |
Cat# GTX76029; RRID:AB_377177 |
| PE anti-human PVR (SKII.4) |
BioLegend |
Cat#: 337609; RRID: AB_2253258 |
| APC anti-PD-L1 (MIH2) |
BioLegend |
Cat#: 393609; RRID: AB_2749926 |
| PE anti-human CD226 (11A8) |
BioLegend |
Cat#: 338305; RRID: AB_2259834 |
| PE anti-human TIGIT (A15153G) |
BioLegend |
Cat#: 372703; RRID: AB_2632729 |
| Pacific Blue anti-human PD-1 (EH12.2H7) |
BioLegend |
Cat#: 329916; RRID: AB_2283437 |
| Biotin anti-human CD3ε (OKT3, mouse monoclonal) |
BioLegend |
Cat#: 317320; RRID: AB_10916519 |
| Anti-GFP |
Invitrogen |
Cat#: A-6455; RRID: AB_221570 |
| Rabbit polyclonal anti-mCherry |
GeneTex |
Cat#: GTX128508; RRID: AB_2721247 |
| Mouse monoclonal anti-phosphotyrosine (pY) |
Sigma-Aldrich |
Cat#: P4110; RRID: AB_477342 |
| Mouse anti-human CD3 zeta pY142 |
BD Bioscience |
Cat#: 558489; RRID: AB_647152 |
| Mouse anti-FLAG M2 |
Sigma-Aldrich |
Cat#: F3165-1MG; RRID:AB_259529 |
| Anti-HA |
Roche Applied Science |
Cat#: 11867423001; RRID:AB_390918 |
| HRP anti-His Tag Antibody |
BioLegend |
Cat#: 652503; RRID: AB_2734520 |
| Rabbit polyclonal anti-GAPDH |
Proteintech Group |
Cat#: 10494-1-AP; RRID: AB_2263076 |
|
| Biological samples |
|
|
|
| NSCLC human sample information |
This paper |
Table S1
|
|
| Chemicals, peptides, and recombinant proteins |
|
|
|
| Collagenase D |
Millipore-Sigma |
Cat#: COLLD-RO |
| DNase I |
Millipore-Sigma |
Cat#: 10104159001 |
| DMEM High Glu w/Gln w/o Pyr. |
Thermo Fisher Scientific |
Cat#: MT10017CV |
| RPMI 1640, w/Gln & 25 mM HEPES |
Corning |
Cat#: MT 10-041-CM |
| Fetal Bovine Serum, Heat Inactivated |
Omega Scientific |
Cat#: FB-02 |
| Paraformaldehyde |
Fisher Scientific |
Cat#: 50980494 |
| SEE super antigen |
Toxin Technologies |
Cat#: ET404 |
| 100 × Penicillin-Streptomycin |
GE Healthcare |
Cat#: SV30010 |
| Polyethylenimine (PEI) |
Fisher Scientific |
Cat#: NC1014320 |
| ATP |
Gold Biotech |
Cat#: A-081-100 |
| 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) |
Avanti Polar Lipids |
Cat#: 850457C |
| 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (POPS) |
Avanti Polar Lipids |
Cat#: 840034C |
| 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl) iminodiacetic acid) succinyl] nickel salt (DGS-NTA-Ni) |
Avanti Polar Lipids |
Cat#: 790404C |
| N-(lissamine rhodamine B sulfonyl)-1,2-dipalmitoyl-sn-glycero-3 phosphoethanolamine (Rhodamine-PE) |
Avanti Polar Lipids |
Cat#: 810158C |
| 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(biotinyl) (sodium salt) |
Avanti Polar Lipids |
Cat#: 870285P |
| 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-5000] ammonium salt (PEG 5000-PE) |
Avanti Polar Lipids |
Cat#: 880230C] |
| GFP-Trap |
Chromotek |
Cat#: gta-20 |
| imidazole |
Sigma-Aldrich |
Cat#: I202 |
| Glutathione Agarose Resin |
Gold Biotechnology |
Cat#: G-250-50 |
| Ni-NTA Resin |
ThermoFisher |
Cat#: Ni-NTA Resin |
| TCEP-HCl |
Gold Biotechnology |
Cat#: TCEP10 |
| Protein G Dynabeads |
ThermoFisher Scientific |
Cat#: 10004D |
| Human PVR -His |
Fisher Scientific |
Cat#: 50-161-4026 |
| Human PD-L1-His |
Sino Biological |
Cat#: 10084-H08H |
| Human ICAM-1-His |
Sino Biological |
Cat#: 10346-H08H |
| Streptavidin |
Invitrogen |
Cat#: S888 |
| SIINFEKL peptide |
AnaSpec |
Cat#: AS-60193-1 |
|
| Experimental models: Cell lines |
|
|
|
| CT26 |
ATCC |
RRID: CRL-2638 |
| B16-F10 |
ATCC |
RRID: CRL-6475 |
| PVR−/−PVRL2−/− B16-F10 |
Du et al., 2018
|
N/A |
| Jurkat E6.1 |
Provided by Dr. Arthur Weiss (University of California San Francisco) |
RRID: CVCL_0065 |
| Raji |
Provided by Dr. Ronald Vale (University of California San Francisco) |
RRID: CVCL_0511 |
| HEK293T |
Provided by Dr. Ronald Vale (University of California San Francisco) |
RRID: CVCL_0063 |
|
| Experimental models: Organisms/strains |
|
|
|
| BALB/c |
The Jackson Laboratory |
N/A |
| CD226−/− mice on BALB/c background |
Du et al., 2018
|
N/A |
|
| Oligonucleotides |
|
|
|
| CD226 Fwd: ggagctctcgagaattctcacgcgtATGGATTATCCTACTTTACTTTTG |
This paper |
N/A |
| CD226 Rev: gcaagcttgatatcctgcagAACTCTAGTCTTTGGTCTGC |
This paper |
N/A |
| TIGIT Fwd: tggagctctcgagaattctcacgATGCGCTGGTGTCTCC |
This paper |
N/A |
| TIGIT Rev: gcaagcttgatatcctgcagacgACCAGTCTCTGTGAAGAAGC |
This paper |
N/A |
| PD-1 Fwd: ggagctctcgagaattctcATGCAGATCCCACAGGCG |
This paper |
N/A |
| PD-1 Rev: aagcttgatatcctgcagacgcgtcaggggccaagagcagtg |
This paper |
N/A |
| PVR Fwd: ggagctctcgagaattctcacgcgtATGGCCCGAGCCATG |
This paper |
N/A |
| PVR Rev: gacccaccagatccacgcgtCCTTGTGCCCTCTGTCTGT |
This paper |
N/A |
|
| Recombinant DNA |
|
|
|
| pHR-CD226-mGFP |
This paper |
N/A |
| pHR-hCD226 (Y322F)-mGFP |
This paper |
N/A |
| pHR-hCD226 (S329A)-mGFP |
This paper |
N/A |
| pHR-hCD226 (Y322F, S329A)-mGFP |
This paper |
N/A |
| pHR-TIGIT-mCherry |
This paper |
N/A |
| pHR-TIGIT (Y225F, Y231F)-mCherry |
This paper |
N/A |
| pHR-TIGIT (AA1-164)-mCherry |
This paper |
N/A |
| pHR-PD-1-mApple |
This paper |
N/A |
| pHR-PD-1 (AA1-197)-mApple |
This paper |
N/A |
| pHR-PD-1-iRFP670 |
This paper |
N/A |
| pHR-PVR-3HA |
This paper |
N/A |
| pHR-SV40-PVR-3HA |
This paper |
N/A |
| pHR-SV40-PVR-tagBFP |
This paper |
N/A |
| pET28a-His10-TIGIT (AA192-244)-LPETG |
This paper |
N/A |
| pET28a-His10-PD-1 (AA194-288)-LPETG |
Hui et al., 2017
|
N/A |
| pET28a-GST-TIGIT (AA192-244)-TwinStrep |
This paper |
N/A |
| pET28a-GST-TIGIT (AA192-244, Y225F, Y231F)-TwinStrep |
This paper |
N/A |
| pGEX-6P-2-GST-PreSci site-PD-1(AA194-288) |
Xu et al., 2020
|
N/A |
| pGEX-6P-2-GST-PreSci site-PD-1(AA194-288, Y223F, Y248F) |
Xu et al., 2020
|
N/A |
|
| Software and algorithms |
|
|
|
| FlowJo v10.5.3 |
FlowJo, LLC. |
https://www.flowjo.com
|
| GraphPad Prism v5, v8, and v9.3.1 |
GraphPad Software, Inc |
https://www.graphpad.com
|
| xCELLigence RTCA MP System |
Agilent |
https://www.agilent.com
|
| R (v4.0.0) |
R Development Core Team, 2008 |
http://www.r-project.org
|
| Seurat v3.2.0 |
Stuart et al., 2019
|
N/A |
| Fiji |
MPI-CBG |
PMID: 22743772; RRID: SCR_002285 |
| Micro-Manager |
Github |
PMID: 25606571; RRID: SCR_000415 |
|
| Other |
|
|
|
| 96 well glass bottom plate |
Cellvis |
P96-1.5H-N |
| Sequence data, analyses, and resources related to scRNA-seq |
This paper; Wu et al., 2020
|
N/A |
| NSCLC CyTOF dataset (Repository ID: FR-FCM-Z3NA) |
This paper; Banchereau et al., 2021
|
http://www.flowrepository.org
|
