Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used
| Probe | Locationa | Sequence 5′→3′ | Source or reference |
|---|---|---|---|
| Lm3 | 1412–1432 (16S rRNA) | CGGGTGCTNCCCACTTTCATG | 11 |
| P0 | 6–28 (16S rRNA) | GAGAGTTTGATCCTGGCTCAG | 5 |
| 338F | 321–338 (16S rRNA) | GCTGCCTCCCGTAGGAGT | 1 |
| Bflact2 | 991–1009 (16S rRNA) | GTGGAGACACGGTTTCCC | This study |
| Bflact5 | 1651–1671 (16S-23S spacer region) | CACACCACACAATCCAATAC | This study |
