TABLE 2.
Strains, plasmids, and oligonucleotides used in this study
| Strain, plasmid, or oligonucleotide | Description | Source or reference |
|---|---|---|
| Strains | ||
| PAO1 | P. aeruginosa wild-type model strain | WTa |
| Δds | PAO1 containing an in-frame deletion of the ds operon | 10 |
| ΔxcpQ | PAO1 containing an in-frame deletion of the xcpQ gene | This study |
| ΔxcpQ(pBB-xcpQ) | ΔxcpQ strain containing plasmid pBB-xcpQ | This study |
| PAO1(pBB-PA3727-lacZ) | PAO1 strain containing plasmid pBB-PA3727-lacZ | 11 |
| ΔxcpQ(pBB-P3727-lacZ) | ΔxcpQ strain containing plasmid pBB-PA3727-lacZ | This study |
| PAO1-GFP | PAO1 strain expressing GFP | 10 |
| ΔxcpQ-GFP | ΔxcpQ strain expressing GFP | This study |
| OneShot TOP10 | E. coli used for plasmid propagation | Invitrogen |
| S17-1λpir | E. coli used as donor strain for the introduction of suicide plasmids into P. aeruginosa | 41 |
| Plasmids | ||
| pBBR1MCS | Conjugative multipurpose cloning vector able to replicate in P. aeruginosa | 42 |
| pEX100Tlink | Suicide vector used for allelic replacement in P. aeruginosa | 43 |
| pEX-xcpQ | pEX100Tlink containing the xcpQ gene of PAO1 | This study |
| pEX-DxcpQ | pEX-PA2076 containing an in-frame deletion of xcpQ | This study |
| pBB-xcpQ | pBBR1MCS expressing xcpQ | This study |
| pBB-PA3727-lacZ | pBBR1MCS expressing lacZ under the xcpQ promotor | 11 |
| Oligonucleotides | ||
| xcpQ-BamHI-FW | For internal deletion of xcpQ/gatcggatcccgaacgactggaaggggc | This study |
| xcpQ-BamHI-RV | For internal deletion of xcpQ/gtcattataaaacgccaaccagttgttcgat | This study |
| xcpQ-HindIII-RV | For cloning xcpQ in pEX100Tlink and pBBR1MCS/gtcaaagcttaccggtccgatgctgctgg | This study |
| xcpQ-SacI-FW | For cloning xcpQ in pEX100Tlink and pBBR1MCS/tcaggagctcccacgagtcgatccgcag | This study |
a
Source: Washington University, Manoil lab.