Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
DIG-Labeled Mitochondrial DNA Probe Sequences
| Target | Name | Sequence |
|---|---|---|
| Mitochondrial DNA | Forward-human NADH dehydrogenase 1 | CCCTACTTCTAACCTCCCTGTTCTTAT |
| Reverse-human NADH dehydrogenase 1 | CATAGGAGGTGTATGAGTTGGTCGTA | |
| Forward-human NADH dehydrogenase 5 | ATTTTATTTCTCCAACATACTCGGATT | |
| Reverse-human NADH dehydrogenase 5 | GGGCAGGTTTTGGCTCGTA | |
| Forward-human ATP synthase membrane subunit 6 | CATTTACACCAACCACCCAACTATC | |
| Reverse-human ATP synthase membrane subunit 6 | CGAAAGCCTATAATCACTGTGCC |
