Figure 10.

Schematic diagram for the genetic modification to generate NE KO mice. (A) Schematic diagram of the genetic modification strategy to generate NE KO mice. (B) Representative gel images of PCR product in genotyping analysis to detect genetic modification of NE using primers (forward: gaacacagcccaccatggcag; reverse: gcatggacattgagggctaagagg). (C) Immunoblotting analysis of NE in primary bone marrow cells isolated from 10-week-old male NE KO mice and age-matched WT controls.