Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences.
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| β-actin | accgagcatggctacagcgtcacc | gtggccatctcttgctcggagtct |
| Il-6 | cccttcaggaacagctatgaa | acaacatcagtcccaagaagg |
| Mcp-1 | cgtgctgtctcagccagat | ggatcatcttgccagtgaatg |
| Tnfα | gcccagaccctcacactc | ccactccagctgctcctct |
