TABLE 1.
Capture probe or detector | Probe sequence (5′ to 3′) |
---|---|
Capture probes | |
Geobacter chapellei-214 | AGACTCATCTGATGACAGAA |
Geobacter arculus-214 | GGACCCATCCTGATACGGTA |
Geobacter metallireducens-214 | GGACTCATCCAGTGACAAAA |
Geobacter sulfurreducens-214 | GGACTCATCCGAAGACAGGA |
Geobacter akaganeitreducens-214 | GGACTCATCCGATGTCGGGA |
Geobacter chapellei-420 | CACAATACACTTCTTTCCCCTT |
Geobacter arculus-420 | CCAGCCCCATTTCTTCCCTTCT |
Geobacter metallireducens-420 | CCTCAATCACTTCTTCCCTCCC |
Geobacter sulfurreducens-420 | TCTCAATCATTTCTTCCCTCCC |
Desulfovibrio desulfuricans-997 | GGGAGGGTTCCGTGGATGTC |
Desulfovibrio vulgaris-996 | GGGAGGGTCTTCCGGATGTC |
Escherichia coli-466 | TCAATGAGCAAAGGTAT |
Detector probes | |
Geobacter-214 chaperone | Biotin-ACCAACTAGCTAATGGTACGC |
Geobacter-420 chaperone | Biotin-GACAGAGCTTTACGACCCG |
Desulfovibrio chaperone | AAACCTAGGTAAGGTTCTTC-biotin |
Escherichia coli chaperone | ACTTTACTCCCTTCCTCC-biotin |
Universal 519 | Biotin-CAGCAGCCGCGGTAATWC |
Universal 915 | Biotin-GCCCCCGYCAATTYCT |
Universal 1392 | Biotin-ACGGGCGGTGTGTRC |
The number after each probe name represents the approximate position of the complementary target region, utilizing G. chapellei or D. desulfuricans 16S rRNA numbering.