Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) |
C57BL/6J | Jackson Laboratory | Stock no. 000664 | 6–8 weeks |
| Strain, strain background (influenza A virus) | A/PR8/34 (H1N1) | BEI Resources, NIAID, NIH | NR-348 | |
| Antibody | Anti-HK2 (rabbit monoclonal) | Cell Signaling Technology | Cat# C64G5 | WB (1:1000) |
| Antibody | Anti-LDHA (rabbit polyclonal) | Cell Signaling Technology | Cat# 2012S | WB (1:1000) |
| Antibody | Anti-PHD2/EGLN1 (rabbit monoclonal) | Cell Signaling Technology | Cat# 4835 | WB (1:1000) |
| Antibody | Anti- PHD3/EGLN3 (rabbit polyclonal) | Novus Biologicals | Cat# NB100-303 | WB (1:1000) |
| Antibody | Anti-IL-1β (mouse monoclonal) | Cell Signaling Technology | Cat# 12242 | WB (1:1000) |
| Antibody | Anti-Lamin B1 (rabbit polyclonal) | ProteinTech | Cat# 12987-1-AP | WB (1:1000) |
| Antibody | Anti-HIF-1α (rabbit polyclonal) | Cayman Chemical | Cat# 10006421 | WB (1:500) |
| Antibody | Anti-α-Tubulin (mouse monoclonal) | Sigma | Cat# T6074 | WB (1:20,000) |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody (goat polyclonal) | Cell Signaling Technology | Cat# 7074 | WB (1:2500) |
| Antibody | Anti-mouse IgG, HRP-linked Antibody (horse polyclonal) | Cell Signaling Technology | Cat# 7076 |
WB (1:2500) |
| Antibody | CD16/CD32 (FcBlock) (rat monoclonal) |
BD Biosciences | Clone 2.4G2; Cat# 553141 | Flow cytometry (1:50) |
| Antibody | Alexa Fluor 700 anti-mouse Ly-6G (rat monoclonal) | BioLegend | Clone 1A8; Cat# 553141 | Flow cytometry (1:250) |
| Chemical compound, drug | FG-4592 (roxadustat) | Cayman Chemical | Cat# 15294 | |
| Chemical compound, drug | Recombinant mouse M-CSF | BioLegend | 576406 | |
| Chemical compound, drug | Oligomycin | Fisher Scientific | 49-545-510MG | |
| Chemical compound, drug | FCCP | MilliporeSigma | C2920 | |
| Chemical compound, drug | Antimycin A | MilliporeSigma | A8674 | |
| Chemical compound, drug | Rotenone | MilliporeSigma | R8875 | |
| Chemical compound, drug | Lipopolysaccharide | Santa Cruz | sc-3535 | |
| Commercial assay or kit | Mouse IL-6 DuoSet ELISA | R&D Systems | DY406 | |
| Commercial assay or kit | Mouse TNF-α DuoSet ELISA | R&D Systems | DY410 | |
| Commercial assay or kit | Mouse KC DuoSet ELISA | R&D Systems | DY453 | |
| Commercial assay or kit | Mouse CCL2 DuoSet ELISA | R&D Systems | DY479 | |
| Commercial assay or kit | Mouse IL-1β alpha DuoSet ELISA | R&D Systems | DY401 | |
| Commercial assay or kit | Lactate Assay Kit | MilliporeSigma | MAK064-1KT | |
| Commercial assay or kit | Mouse Macrophage Nucleofector Kit | Lonza | VPA-1009 | |
| Commercial assay or kit | Seahorse XFe24 FluxPak | Agilent | 102340-100 | |
| Commercial assay or kit | NE-PER Nuclear and Cytoplasmic Extraction Reagents | Thermo Fisher | Cat# 78833 | |
| Other | PKH26 Cell Linker Dye for Phagocytic Cell Labeling | MilliporeSigma | Cat# PKH26PCL-1KT | Dye to distinguish between TR-AMs and Mo-AMs |
| Other | SYTOX Green Nucleic Acid Stain | Thermo Fisher | Cat# S7020 | Stain to distinguish between live and dead cells. |
| Sequence-based reagent | Rpl19_F | This paper | PCR primers | CCGACGAAAGGGTATGCTCA |
| Sequence-based reagent | Rpl19_R | This paper | PCR primers | GACCTTCTTTTTCCCGCAGC |
| Sequence-based reagent | Il6_F | This paper | PCR primers | TTCCATCCAGTT GCCTTCTTGG |
| Sequence-based reagent | Il6_R | This paper | PCR primers | TTCCTATTTCCA CGATTTCCCAG |
| Sequence-based reagent | Tnfa_F | This paper | PCR primers | AGGGGATTAT GGCTCAGGGT |
| Sequence-based reagent | Tnfa_R | This paper | PCR primers | CCACAGTCCAGGTCACTGTC |
| Sequence-based reagent | Il1b_F | This paper | PCR primers | GCCACCTTTT GACAGTGATGAG |
| Sequence-based reagent | Il1b_R | This paper | PCR primers | GACAGCCCA GGTCAAAGGTT |
| Sequence-based reagent | Kc_F | This paper | PCR primers | AGACCATGGC TGGGATTCAC |
| Sequence-based reagent | Kc_R | This paper | PCR primers | ATGGTGGCTATGACTTCGGT |
| Sequence-based reagent | Ccl2_F | This paper | PCR primers | CTGTAGTTTTT GTCACCAAGCTCA |
| Sequence-based reagent | Ccl2_R | This paper | PCR primers | GTGCTGAAGA CCTTAGCCCA |
| Sequence-based reagent | Non-targeting (control) siRNA | Dharmacon | D-001810-01 | |
| Sequence-based reagent | Hif1a #1; J-040638-06 | Dharmacon | J-040638-06 | |
| Sequence-based reagent | Hif1a #2; J-040638-07 | Dharmacon | J-040638-07 | |
| Software, algorithm | FastQC | Babraham Institute | RRID:SCR_014583 | |
| Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | |
| Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 | |
| Software, algorithm | Reactome Cytoscape Plugin | PMID:14597658 | RRID:SCR_003032 | |
| Software, algorithm | Prism 9 | GraphPad | RRID:SCR_002798 |